Will Mark Brainiest. What are 6 physical properties of mountains and 2 chemical properties?

Answers

Answer 1

Answer:

Examples of chemical properties include flammability, toxicity, acidity, reactivity (many types), and heat of combustion.

Physical properties are those that can be observed without changing the identity of the substance. ... Properties that describe how a substance changes into a completely different substance are called chemical properties.

Explanation:

Flammability and corrosion/oxidation resistance are examples of chemical properties.


Related Questions

Stimulation of the heat-loss center causes __.
a. blood vessels in the skin to constrict
b. breathing to become slow and shallow
c. sweat glands to increase their output
d. all of the above​

Answers

Answer:

c

Explanation:

because the blood vessels dilate allowing more blood to flow near the surface of the skin allowing the sweat glands to increase the amount of sweat secreted which evaporates and takes heat with it

Stimulation of the heat-loss center causes a. blood vessels in the skin to constrict.

The heat-loss center is a region in the brain that plays a crucial role in regulating body temperature. When this center is stimulated, it initiates responses aimed at dissipating excess heat from the body. Among the options provided:

a. Blood vessels in the skin constrict: Stimulation of the heat-loss center leads to the constriction of blood vessels in the skin, a process known as vasoconstriction. This response reduces blood flow to the skin, minimizing heat loss through the skin's surface. By constricting blood vessels, less warm blood reaches the skin, helping to retain heat deeper within the body.

b. Breathing becomes slow and shallow: This response is more associated with the heat-conservation center. During cold conditions, slow and shallow breathing reduces the exchange of cold air in the lungs, helping to retain warmth.

c. Sweat glands increase their output: This response is associated with the heat-loss center, but in this scenario, the heat-loss center's stimulation would have the opposite effect by decreasing sweat production. Sweating is a cooling mechanism employed by the body to release excess heat through evaporative cooling.

In conclusion, the correct response is a. blood vessels in the skin to constrict when the heat-loss center is stimulated. This vasoconstriction reduces heat loss through the skin and helps to maintain core body temperature.

To learn more about heat-loss center, here

https://brainly.com/question/33362885

#SPJ3

Mention ten example of plants​

Answers

Answer:

Herbs.  

Shrubs.  

Trees.  

Climbers.  

Creepers.

trees, grass, moss, flowers, and weeds,

Explanation: ya

Answer:

Trees

Flowers

Moss

Grasses

Algae

Fern

Reeds

Bamboo

Herbs and

Shrubs

Explanation:

Hope this helps

calcitoninstimulates bone resorption (breakdown).is synthesized by the skin, liver, and kidneys.increases blood calcium.stimulates osteoblast activity.

Answers

The term Calcitonin stimulates osteoblast activity which is given by the option A.

Your thyroid gland produces and releases the hormone known as calcitonin, which works by lowering the amount of calcium in your blood to help control it. The parathyroid hormone, a hormone that raises your blood calcium levels, is inhibited by calcitonin.

Your thyroid is a tiny, butterfly-shaped gland that is covered by skin at the front of your neck. It is a component of your endocrine system and manages a number of crucial bodily processes by creating and releasing certain hormones. Your thyroid's C-cells, also known as parafollicular cells, produce and release calcitonin.

Hormones are substances that communicate with your organs, muscles, and other tissues through your blood to coordinate various bodily operations. These messages instruct your body on what to do when.

Learn more about Calcitonin:

https://brainly.com/question/29455256

#SPJ4

Complete question:

Calcitonin

A. stimulates osteoblast activity

B. is synthesized by the skin, liver, and kidneys

C. increases blood calcium

D. stimulates bone resorption (breakdown)

approximately 66 percent of our body water is found in the extracellular fluid. t/f

Answers

False. About two-thirds (67%) of our body water is found in the intracellular fluid. The remaining 33% is found in the extracellular fluid.

What is intracellular fluid?

Intracellular fluid (ICF) is the fluid contained within the cells of the body. It is primarily composed of water and electrolytes such as potassium, sodium, chloride, and magnesium. It is essential for cellular metabolism, homeostasis and providing a medium for biochemical reactions. It also helps regulate the osmotic pressure of the cells, which is important in controlling the movement of molecules across the cell membrane. ICF is separated from the extracellular fluid (ECF) by the cell membrane, which is selectively permeable and allows certain molecules to enter or exit the cell. ICF is constantly in a state of flux, with molecules being exchanged between the ICF and ECF. The concentration of electrolytes and other molecules in the ICF can be regulated by various membrane transporters and ion channels, which maintain a balance of electrolytes and other molecules within the cell.

To learn more about intracellular fluid

https://brainly.com/question/14445684

#SPJ1

the no grouse allele is dominant over the grouse allele. if a pigeon homozygous for the grouse allele mates with a heterozygous pigeon, what is the

Answers

If a pigeon homozygous for the grouse allele mates with a heterozygous pigeon, the expected frequency of the feathery-legged (grouse) phenotype in the offspring will be 0%. The correct answer is A.

If a pigeon is homozygous for the no grouse allele, it means that it carries two copies of the dominant allele, which masks the expression of the recessive grouse allele.

On the other hand, a heterozygous pigeon has one copy of the no grouse allele and one copy of the grouse allele.

In this case, the no grouse allele is still dominant and masks the expression of the grouse allele, but the grouse allele can be passed on to its offspring.

Therefore, when a homozygous pigeon for the no grouse allele (NN) mates with a heterozygous pigeon (Nn), all offspring will inherit one copy of the no grouse allele from the homozygous parent and one copy of either the no grouse or the grouse allele from the heterozygous parent.

The possible genotypes and their corresponding phenotypes are as follows:

   NN (no grouse allele) = no grouse phenotype

   Nn (no grouse allele) = no grouse phenotype

   Nn (grouse allele) = no grouse phenotype

   nn (grouse allele) = grouse phenotype

Since the no grouse allele is dominant, all offspring with at least one copy of this allele will exhibit the no grouse phenotype.

Therefore, the expected frequency of the feathery-legged (grouse) phenotype in the offspring is 0%, and the correct answer is A) 0%.

For more such answers on alleles

https://brainly.com/question/23516288

#SPJ11

Question

The no grouse allele is dominant over the grouse allele. If a pigeon homozygous for the no grouse allele mates with a heterozygous pigeon, what is the expected frequency of the feathery-legged (grouse) PHENOTYPE in the offspring?

A) 0% B) 50% C) 75% D) 100%

Which step in protein folding requires energy? disrupting favorable interactions between the unfolded polypeptide and water forming hydrogen bonds, as well as other electrostatic and van der Waals interactions forming favorable interactions between the folded polypeptide and water

Answers

The step in protein folding that requires energy is disrupting favorable interactions between the unfolded polypeptide and water.

This step is known as the "energetic barrier" and it must be overcome in order for the protein to fold into its correct conformation. The energy required for this step is provided by the hydrolysis of ATP molecules.

Once the energetic barrier is overcome, the protein can begin to form hydrogen bonds, as well as other electrostatic and van der Waals interactions.

These interactions help to stabilize the folded conformation of the protein. Finally, the protein can form favorable interactions between the folded polypeptide and water, which also helps to stabilize the folded conformation.

In summary, the step in protein folding that requires energy is the disruption of favorable interactions between the unfolded polypeptide and water. This step is necessary in order for the protein to overcome the energetic barrier and fold into its correct conformation.

To know more about polypeptide click on below link:

https://brainly.com/question/28270191#

#SPJ11

in the process of photosynthesis plants use the energy in

Answers

In the process of photosynthesis, plants use the energy in sunlight.

Photosynthesis is a biochemical process in which plants, algae, and some bacteria convert light energy from the sun into chemical energy. This energy is harnessed and stored in the form of glucose and other organic molecules.

The main source of energy for photosynthesis is sunlight, which is captured by specialized pigments in plant cells, primarily chlorophyll. This process is crucial for the survival of plants as it enables them to produce their own food and release oxygen into the atmosphere. Understanding the role of sunlight as the energy source in photosynthesis helps in appreciating the significance of sunlight as a fundamental component for the growth and sustenance of plant life on Earth.

To know more about photosynthesis click here:

https://brainly.com/question/29775046

#SPJ11

lmk if you need a better pic ​

lmk if you need a better pic

Answers

A) DNA replication

Hope this helps!

the yellow cast to the skin that indicates liver disease

Answers

The yellow cast to the skin that indicates liver disease is referred to as jaundice.

Jaundice is a condition characterized by a yellow discoloration of the skin and whites of the eyes that indicates an elevated level of bilirubin in the bloodstream. Bilirubin is a yellow-colored substance produced during the natural breakdown of red blood cells in the body.

When the liver is damaged, it is unable to process bilirubin effectively, leading to a buildup of bilirubin in the bloodstream, which causes jaundice. The yellowing of the skin is not the only symptom of liver disease.

Other symptoms may include abdominal pain, swelling, and tenderness, nausea, and vomiting, loss of appetite, fatigue, weight loss, and fever. The severity of the symptoms varies depending on the underlying cause of the liver disease and the stage of the condition.

To know more about jaundice please refer to:

https://brainly.com/question/28251892

#SPJ11

State a hypothesis based on the following:

Based on your understanding of oil, do you think one of your five materials will absorb more oil than the others? If so, which one?

Answers

Hypothesis When comparing the two methods of using absorbent materials and skimming, skimming will be more efficient because absorbent materials absorb more water than oil whereas skimming simply collects oil.

What accounts for the superior oil absorption of some materials over others?

Due to the fact that high porosity materials have a high capacity for oil absorption , highly porous materials are frequently employed as oil absorbents.

In an actual oil spill, how would you clean up the oil-contaminated sorbents?

Skimmers and booms:Booms keep the oil contained so that scanners can gather it.Booms are movable barriers that are erected around the source of the spill of the oil.Skimmers are devices that remove spilt oil off the edge of the water within of the booms. They can be boats, vacuums, sponges, or ropes that absorb oil.

To know more about absorbent materials visit:

https://brainly.com/question/3312509

#SPJ1

anyone can help in this :(

anyone can help in this :(

Answers

Answer:

Pyramids of number show the number of organisms in each trophic level but pyramid of biomass show their total mass. This gets less at each trophic level because every living thing loses most of the energy they take in. Some is lost as heat during respiration and some is lost in the waste products living things excrete. Their consumers can only get the energy left in their tissues.

What is the ultimate purpose of the nuclear reaction in a nuclear power plant

What is the ultimate purpose of the nuclear reaction in a nuclear power plant

Answers

Answer:

I heats water to produce steam thar spins a turbine.

PLEASE HELP!!!!!
What happens to the original DNA strand after transcription?

Answers

Answer:

It changes its form

Explanation:

The DNA strand during this process is copied and "mutate" if I may use the word , the after the new copies are change to molecules that's why at the end of the day we have different blueprints

Transcription is the process by which the information in a strand of DNA is copied into a new molecule of messenger RNA (mRNA). The newly formed mRNA copies of the gene then serve as blueprints for protein synthesis during the process of translation.

What are the similarities and differences between chemiosmosis in mitochondria and chemiosmosis in chloroplasts?

Answers

Answer:Chemiosmosis in mitochondria and chloroplasts is similar because cell organelles possess an electron transport chain in their membrane that establishes a proton gradient. On the other hand, the difference is the energy source in the chemiosmosis of mitochondria and chloroplasts.

Explanation:Chemiosmosis in mitochondria and chloroplasts is similar because cell organelles possess an electron transport chain in their membrane that establishes a proton gradient. On the other hand, the difference is the energy source in the chemiosmosis of mitochondria and chloroplasts.

How many different types of gametes will be produced by a plant having genotype AABbCc?A1B2C3D4

Answers

A plant having genotype AABbCc will produce 4 different types of gametes.

Thus, the correct answer is D.

In order to determine the different types of gаmetes thаt а plаnt will produce, we must first look аt the genotype of the plаnt. The genotype of the plаnt is ААBbCc, which meаns thаt it hаs one dominаnt аllele for eаch of the three genes (А, B, аnd C) аnd one recessive аllele for eаch of the three genes (b аnd c).

To determine the different types of gаmetes thаt will be produced, we must look аt the possible combinаtions of these аlleles. There аre four different combinаtions of these аlleles thаt cаn be produced: АBc, АbC, аBC, аnd аbc. These combinаtions will result in four different types of gаmetes thаt will be produced by the plаnt.

For more information about genotype refers to the link: https://brainly.com/question/29156144

#SPJ11

Give a well detailed explanation on an Osmosis Setup.​

Answers

Explanation:

Reverse Osmosis is a technology that is used to remove a large majority of contaminants from water by pushing the water under pressure through a semi-permeable membrane

Consider the cell body of a neuron. through which types of ion channel might sodium enter the cell body?

Answers

To balance out negative charges on the interior of the membrane, voltage-gated sodium channels open, allowing sodium ions to enter the cell.

There are two factors that draw sodium ions (Na+) to the inside of neurons while they are at rest. The (Na+) ion is pushed into the cell down the concentration gradient by the high concentration of (Na+) outside the cell. Similar to how the positively charged (Na+) inside the neuron is drawn in by the electrostatic pressure caused by the negative charge inside.

Which of the four ion channel types are they? Ion channels that are voltage-gated, Linguistic-gated ion channels (also known as ionotropic receptors), ion channels with light-gated, Ion channels with mechanosensitivity, Nucleotide-gated ion channels that cycle, and Ion channels that are calcium-gated.

Learn more about Neurons https://brainly.com/question/24217914

#SPJ4

What is an example of physical contamination in food?

Answers

Hair is a good example of physical contamination in food.

cross contamination: what is it?Contaminants can enter food in a variety of ways, including during production, processing, or cooking.Food isn't always immediately exposed to contaminants. Cross-contamination is the unintentional introduction of pathogens from a surface, item, or person into the food. The four most typical causes of cross-contamination are bugs, food handlers, utensils, and clothing.When people refer to cross-contamination, they typically mean biological or allergenic pollutants, however any of the four contaminants may be involved.Physical contamination: what is it?Foreign things that contaminate food are referred to as physical contamination. Between farm and table, it can occur at any time.Physical contaminants can lead to injuries including choking, cutting, or tooth damage, but they can also introduce dangerous bacteria that have their own risks. Finding something in one's meal can be highly upsetting, even if one is not sick or hurt.

Learn more about Physical contamination here:

https://brainly.com/question/2600140

#SPJ4

Explain the process of opening and closing the stomata

Answers

Answer:

The opening and closing of stomata depend on the turgor pressure, caused by the osmotic flow of water in the guard cells. When the guard cells are turgid, they expand resulting in the opening of stomata. When the guard cells lose water, they become flaccid leading to stomatal closure. Stomata normally open when the light strikes the leaf and close during the night. Also read-Transpiration

Explanation:

what can we do to minimise overuse of plastic?​

Answers

Here are some steps :-

AVOID using plastic bottles.Use JUTE BAGS or CLOTH BAGS , instead of plactic.RECYCLE PLASTICS in an useful way.Make your friends, family, neighbors and society aware about "NO TO PLASTIC ".Avoid using DISPOSALS PLASTIC .Minimize the use of PACKED ITEMS.

THESE ARE THE SMALL STEPS WE CAN TAKE TO MINIMISE THE OVERUSE OF PLASTIC, AND PROTECT OUR EARTH .

BUT WE NEED EVERYONE'S SUPPORT TO MAKE THIS BIG CHANGE.

STAY SAFE, STAY HEALTHY AND BLESSED.

HAVE A BLESSED DAY !

THANK YOU !

The diagram below represents the chemical pathway of a process in a human liver cell.A particular liver cell is unable to make substance C. One possible explanation for the inability of this cell to make substance C is that

Answers

Answer: nuclear DNA was altered resulting in the cell being unable to make enzyme Y.

Explanation:I don’t have an explanation I just took the test and got the answers

State lab review packet answers diffusion through a membrane -beaks of finches - making connections - relationships and bio diversity

Answers

Answer:

Diffusion can happen with or without a membrane. It always takes place down a concentration gradient, which means the substance will diffuse from an area  of higher concentration to an area of lower concentration.

Biodiversity is critical to maintaining the balance of the ecosystem. Without a diverse collection of organisms, the species in the environment cannot thrive and are at a risk of extinction in extreme cases.

Hope that answers the question, have a great day!

Pls, I need help with this! Biology Thank you :)

Pls, I need help with this! Biology Thank you :)

Answers

Answer:

If its dna replication the answer will be TCCCCTAGTCGTGGCCTAAAGTACTCGG

If its transcription the answer will be UCCCCUAGUCGUGGCCUAAAGUACUCGG

Explanation:

_____ thought capitalism would inevitably lead to revolution
because there is contradiction between the wealth created for some
and the immiseration and poverty created for others .

Answers

The person who thought capitalism would inevitably lead to revolution because there is a contradiction between the wealth created for some and the immiseration and poverty created for others was Karl Marx. Marx's idea of capitalist exploitation is that it is a mechanism by which the bourgeoisie

(owners of the means of production) would accumulate more than 100% of the value of a worker's work since the laborer receives only a tiny portion of the value of their work while the rest goes to the capitalist who owns the means of production. Marx argued that capitalism is inherently exploitative and that workers would eventually become aware of this and rise up in a revolution to overthrow the capitalist system. He predicted that this would happen because capitalism creates an inherent conflict between the working class, who are exploited, and the capitalist class, who own the means of production and control the wealth of society.

To know more about accumulate visit:

https://brainly.com/question/32115201

#SPJ11

The food we eat provides the needed for life functions.

Answers

Answer:

it depends on what your eating when you eat your body digests the food and uses what it can to provide what your body needs  

Explanation:

the most common cognitive disturbance in anorexia nervosa is:

Answers

The most common cognitive disturbance in anorexia nervosa is body image distortion.

What is Body image distortion ?

A distorted sense of one's own body's size, form, or weight is referred to as body image distortion. Even when they are substantially underweight, people with anorexia nervosa frequently have a mistaken perception of their bodies and believe they are heavier or larger than they actually are.

One of the key characteristics of anorexia nervosa is cognitive dysfunction, which can support the emergence and maintenance of disordered eating patterns. It could result in rigid food habits, excessive exercise, and a strong fear of putting on weight.

Learn more about anorexia nervosa here : brainly.com/question/7283412

#SPJ4

lactate buildup in working muscles: group of answer choices raises blood ph to indicate that muscles have not worked enough. produces a large amount of energy to be used by the muscles. indicates that anaerobic breakdown of glucose has occurred. causes muscle fatigue.

Answers

Lactate buildup in working muscles indicates that an anaerobic breakdown of glucose has occurred.

This process produces a large amount of energy to be used by the muscles, but it also causes muscle fatigue. Lactate also contributes to the decrease in pH in the muscle cells, making them more acidic. This decrease in pH can actually be beneficial in promoting muscle growth and adaptation over time. So, lactate buildup is not an indicator that the muscles have not worked enough, but rather a sign that they have been working hard through anaerobic metabolism.

Learn more about glucose here: https://brainly.com/question/30548064

#SPJ11

reduction of expression of a gene in fruit flies during early development causes the reduction of the anterior structures of one thoracic segment. what type of gene is it most likely to be?

Answers

Decreased gene expression in Drosophila during early development causes a decrease in the anterior structure of the thoracic segment. Segmentation Gene Gene Type Most Likely.

Segmentation genes are genes involved in the early stages of pattern formation, defining repeating units (metamers) in segmented organisms (usually embryos). They are divided into 3 groups: Gap genes, pair rule genes, segment polarity genes. A segmental gene is a general term for genes that have the function of specifying the organizational pattern of each repeating unit of a segmented organism. Animals are made up of segments. However, Drosophila segments also contain compartmentalized compartments. A gene is a segment of deoxyribonucleic acid (DNA) that encodes a specific protein that functions in one or more cell types in the body.

To know more about deoxyribonucleic acid visit:

https://brainly.com/question/13789418?referrer=searchResults

#SPJ4

Can some one help me plzzzzzz

Can some one help me plzzzzzz

Answers

Answer:

you are correct it is it relieves energy from mitochondria

What makes birds and planes similar and different.?

Answers

Answer:

Airplanes have wings, just like birds. They also have a light skeleton (or framework) to decrease their weight, and they have a streamlined shape to decrease drag. The big difference is that airplanes do not flap their wings.

Other Questions
You must always test blood sugar after every meal? Open questions are favored because:a) they do not limit a client's answerb) they address specific topicsc) they allow a client to refuse to answerd) either A & C Find the distance between the pair of points below to the nearest tenth if necessary (0,-5), (4,1) Skin puncture in adult is most often performed using the distal portion of the____________________ For girls ________ is the FIRST sign of being able to have a child; the comparable sign for boys is called ________. aaron corporation, which has only one product, has provided the following data concerning its most recent month of operations: selling price $ 90 units in beginning inventory 0 units produced 3,400 units sold 3,000 units in ending inventory 400 variable costs per unit: direct materials $ 21 direct labor $ 38 variable manufacturing overhead $ 6 variable selling and administrative expense $ 4 fixed costs: fixed manufacturing overhead $ 54,400 fixed selling and administrative expense $ 3,000 what is the unit product cost for the month under variable costing? multiple choice $69 per unit $65 per unit $85 per unit $81 per unit Two Polaroids (polarizers that can polarize visible light) are aligned so that the light passing through them is a maximum. At what angle should one of them be placed so that the intensity is subsequently reduced by half? Le gustaria algo mas? How many members are in the 117 House of Representatives?. A student conducts an experiment to determine how the amount of water given to a plant affects its growth. Which of the following is not a constant or control for this experiment? 2. for five years, prices are increased by the following amounts: $4, $2, -$1, $2, $2. (a) ( 2) find the standard deviation of the distribution of price increases over this period. (b) ( 1) what is the modal price increase during this period? In java, how do I make a scanner class? The representation of a government to other foreign governments is called:________ Enter your answer and show all the steps that you use to solve this problem in the space provided.What is the value of x? This cattle trail ran from Bandera, Texas to Dodge City, Kansas in the late-1800s.3.Question 1 options:Great Western Cattle TrailChisholm TrailSedalia TrailTexas Trail what is 1+3x when x=1 What do you feel toward the little girl? what do you feel toward the father? in lengua para diablo what is the answer please help me you & three friends go to the twin carnival. you have a coupon for $20 off that will save your group money! if the total bill to get into the carnival was 100$ how much does one regular price ticket cost? Define the absorbance value displayed on the spectrophotometer.