WILL GIVE THE BRAINLIEST!!!

List three places chemoreceptors may be located in arthropods.

Answers

Answer 1
brainstem, cerebellum and midbrain

Related Questions

List the angles in order from smallest to largest. Note image in not drawn to scale

List the angles in order from smallest to largest. Note image in not drawn to scale

Answers

Answer:

maybe cab If it's wrong I'm so sorry

Finish the DNA strand using
complementary base pairing rules.
A-G-T-C-T-G-C

Answers

Answer:

T-C-A-G-A-C-G

Explanation:

1
Water Hyacinth is an invasive species that humans have introduced to many parts of the world. It is a plant that fouts on water and
forms groups. It can grow very fast. Over time, water hyscinth can cover the surfaces of ponde, lakes, and rivers,
What will happen to a pond where weter hyacinth plants grow and spread?
The water flow in the pond will increase, which can cause new plant species to grow
B. The amount of water in the pond will increas, which can cause new plant species to grow
C. The sunlight reaching underwater plant species will decreases, which can cause the plants to do
D. The temperature of the water will decrease, which can cause other plant species to die
Roset
Next Question

1Water Hyacinth is an invasive species that humans have introduced to many parts of the world. It is

Answers

Answer:

C

Explanation:

This is the probably the most logical and correct answer. As the water hyacinth cover the surface of the water, the aquatic plants in the water will not have enough light for photosynthesis.

Cyanobacteria, once referred to as blue-green algae, has a fossil record that dates back nearly 3.5 billion years and is among the oldest fossils known. The cyanobacteria/ blue-green algae had cell walls and were photosynthetic. A few hundred years ago, this organism was classified as a plant, then as a protist. Today it is classified in the Eubacteria because it

A) is the ancestor of land plants.is the ancestor of land plants.
B) is photosynthetic.is photosynthetic.
C) has cellulose cell walls and chloroplasts.has cellulose cell walls and chloroplasts.
D) is known to be prokaryotic.

Answers

Cyanobacteria, once referred to as blue-green algae, has a fossil record that dates back nearly 3.5 billion years and is among the oldest fossils known. Today it is classified in the Eubacteria because it is known to be prokaryotic.. Option D is the answer.

Cyanobacteria and prokaryotes

Cyanobacteria are classified in the Eubacteria because they are prokaryotic organisms. Although they are photosynthetic and have cell walls, they are not classified as plants or protists because they lack many of the complex cellular structures and processes found in eukaryotic organisms. Instead, they are classified in the domain Bacteria, which includes all prokaryotic organisms.

Prokaryotes are unicellular microorganisms that lack a well-defined nucleus and other membrane-bound organelles. They are the simplest and most ancient form of life on Earth, and include the bacteria and archaea. Prokaryotic cells are typically smaller and simpler in structure than eukaryotic cells, which are found in plants, animals, fungi, and protists.

Learn more about prokaryotes here https://brainly.com/question/13194999

#SPJ1

what's 9+10 ijiivtrzxr7rx7r​

Answers

Answer:

19

Explanation:

Answer:

9 + 10

is 19 is your answer

Bacterial endosymbionts have lost much of their genome and are dependent upon their aphid hosts for survival. Similarly, the aphids depend on the endosymbiotic bacteria for the supply of amino acids that they provide. This interdependence is the result of

Answers

Answer:

Coevolution

Explanation:

Coevolution is my best guess as it answer our question of dependence of species on one another for survival brought primarily by natural selection (evolution)

pyrethroid pesticides exert their toxicity in the form of

Answers

A nerve poison with symptoms similar to chlorinated hydrocarbons

PROMPT: Write an essay in which you explain how Terra Snider builds an argument to
persuade her audience that middle and high schools should open later. In your essay, analyze
how Snider uses one or more of the features in the directions that precede the passage (or
features of your own choice) to strengthen logic and persuasiveness of her argument. Be sure
that your analysis focuses on the most relevant features of the passage.
Your essay should not explain whether you agree with Snider's claims, but rather explain how
Snider builds an argument to persuade her audience.

Answers

The assignment wants to know how you interpret the argument and how you develop an essay. For that reason, I can't write your essay, but I'll show you how to write it.

Essay structureIntroduction: Introduce the subject that the essay will address, that is, show who Terra Snider is, what she stands for, and how she wants to persuade the public to agree with her. The introduction must be a short paragraph.

Body: Write at least two paragraphs. These paragraphs should be long because you will need to detail Snider placements. The first paragraph shows how she uses the resource known as logos to show the logic of her argument, and how she uses the resource known as ethos to show her knowledge of the subject. In the second paragraph, reinforce how Snider presents evidence to show how the arguments contrary to hers are incorrect and do not represent something that should be encouraged in society.

Conclusion: Write one more short paragraph where you address the most important points of your essay and reinforce whether or not Snide is effective in her argument.

Below you can see an example of how your introduction might be written.

Terra Snider is an activist and co-creator of the movement formed by parents and teachers who seek a change in school schedules. Snider says that classes should start later, as they would optimize students' sleep and promote a series of positive effects.

Learn more about writing essays:

https://brainly.com/question/8407102

#SPJ1

How do you think convection currents work underground? Your opinion 6th grade math

Answers

Answer:

As convection currents reach the mantel, the heat causes a collision between the continental plate and the oceanic plate under water. The convection current continues to push the heated magma past the mantel level, reaching the crust of the Earth's surface and producing a lava spout.

Explanation:

Answer:

energy in the earth does a repetitive action and it make a convection current

Explanation:

1. Why is cell division important

Answers

Answer:

Cell division is important because it serves as a means of reproduction in unicellular organisms through binary fission.

Four equal strips A B C and D were cut from a potato whose cell sap concentration was 28.5%sugar. The strips were placed in sugar solutions of different concentrations as follows;A-10%,B-15%,C-25%,D-35%. 1.What changes would you expect in strips A and D? 2.Account for the changes in A and D.​

Answers

Answer: The concentration of sugar in solution D is 35%. Solution D is a hypertonic solution as the solute concentration is more than the potato cell concentration. Therefore, water will move into the cell to equalize the osmotic pressure gradient between the cell and the solution. Hence, strip D will swell.

Explanation:

Quagga mussels, an invasive species of mollusk originally from
Russia, have been introduced to the lake after being carried in on
the hulls of boats. An assessment of the size of the quagga
mussel problem is needed, along with suggestions to curb their
population growth.
what field of science is this?

Answers

This is a problem in the field of ecology.

The problem of quagga mussels in the lake is an ecological issue that requires scientific assessment and management.

It falls under the discipline of ecology, which studies the relationships between organisms and their environment.

Ecologists investigate the impacts of invasive species on the ecosystem and devise strategies to control their spread and minimize their effects.

In this case, scientists will need to examine the size of the quagga mussel population, their distribution, and their ecological interactions with native species.

They will also need to recommend measures to prevent further introduction of quagga mussels and to manage their population growth, such as using chemical treatments or biological controls.

For more such questions on ecology, click on:

https://brainly.com/question/842527

#SPJ11

what is the ratio of elements found in carbohydrates?

Answers

Answer:

I believe it is a 1:2:1 ratio

Explanation:

Answer:

Carbohydrates are a class of chemical compounds composed of carbon, hydrogen, and oxygen in 1:2:1 ratio, respectively.

Explanation:

Translate the DNA, mRNA, amino acid shown in picture (DNA sample)

DNA:
mRNA:
amino acid:

TACGCCTTTACT TACTCGTCAATT TACCCGACGACCACT TACTACTAGATC TACCACCACACT TACTCATCGATC TACTGGTAAGTAACT TACTTTCAGGGTACT

Translate the DNA, mRNA, amino acid shown in picture (DNA sample)DNA: mRNA: amino acid:TACGCCTTTACT TACTCGTCAATT

Answers

DNA: DNA stands for Deoxyribonucleic Acid, which is a molecule that contains the genetic instructions for the development, functioning, and reproduction of all living organisms.

It is a long, double-stranded molecule made up of four types of nucleotides: adenine (A), thymine (T), guanine (G), and cytosine (C).

TACGCCTTTACTTACTCGTCAATTTACCCGACGACCACTTACTACTAGATCTACCACCACACTTACTCATCGATCTACTGGTAAGTAACTTACTTTCAGGGTACT

mRNA:

mRNA stands for Messenger Ribonucleic Acid, which is a type of RNA molecule that carries the genetic information from DNA to the ribosomes, where it serves as a template for protein synthesis.

mRNA is synthesized through a process called transcription.

AUGCGGAAAUGAAUGAGCAGUAAAUUGGGCUGUGCUGGUGAAUGAUGGUGGUGUGAUGAGUAGUAGGUGGUAGAUGAUGACCAUUCACCCAUUGAGUCA

Amino acid:

Amino acids are the building blocks of proteins. They are organic compounds made up of an amino group (-NH2), a carboxyl group (-COOH), and a side chain that is specific to each amino acid. There are 20 different amino acids that are commonly found in proteins, each with a different side chain that gives it unique properties.

Met-Arg-Lys-Asp-Arg-Gln-Stop-Leu-Gly-Leu-Cys-Trp-Val-Asn-Asp-Val-Val-Val-Asp-Ser-Val-Gly-Asp-Met-Leu-Pro-Leu-Glu-Ser

To know more about amino acid, visit :

https://brainly.com/question/14583479

#SPJ1

Confused:( I’m currently a high school student but I’m taking this college anthro 1 online class since my counselor said I need it for my transcript but I’m so lost in this last question :[

Confused:( Im currently a high school student but Im taking this college anthro 1 online class since

Answers

Answer: 5a. 0%    5b. 50%    5c. 50%

Explanation: It is asking for you to cross an individual who is heterozygous for this trait, Ee, with someone who has attached earlobes.  Because this is the recessive trait they must be ee. With that in mind your Punnett Square should be an Ee x ee. So 0% of the offspring will be homozygous dominant, EE. 50% will be homozygous recessive, ee. And 50% will be heterozygous, Ee.

Hope this helps.

Black-footed ferrets are native to the Great Plains. They spend most of their
time underground in prairie dog burrows. Which factor would increase an
area's carrying capacity for black-footed ferrets?
A. Increased competition for space
B. Increased number of diseases
C. Increased number of predators
D. Increased availability of food

Answers

Answer:

D. Increased availability of food

Explanation:

Trust

The factor that would increase an area's carrying capacity for black-footed ferrets is the increased availability of food. The correct option is D.

What is carrying capacity?

Carrying capacity is defined as the average population size of a species in a given habitat.

Environmental factors such as adequate food, shelter, water, and mates limit the species population size. If these requirements are not met, the population will decline until the resources recover.

If there is more food available in an area, more black-footed ferrets can survive and reproduce, increasing the species' carrying capacity.

Increased competition for space, more diseases, and more predators would all reduce the carrying capacity of black-footed ferrets by reducing the number of individuals that could survive and reproduce in the area.

Thus, the correct option is D.

For more details regarding carrying capacity, visit:

https://brainly.com/question/30880725

#SPJ7

EOS evolution review answers

Answers

EOS lip balms stand out due to their innovative design, natural ingredients, variety of flavours, long-lasting formula, and commitment to quality and user satisfaction.

EOS (Evolution of Smooth) lip balms have introduced several key advancements and improvements compared to traditional lip balms. Here are some notable features:1. Unique Shape and Design: EOS lip balms come in a distinctive spherical shape, making them easy to apply and enhancing the user experience. The design allows for smooth and even coverage, while the shape makes it convenient to locate in bags or pockets.2. Natural and Nourishing Ingredients: EOS lip balms prioritize natural ingredients, such as shea butter, jojoba oil, and vitamin E, which provide deep hydration and nourishment for the lips. These ingredients help to keep the lips moisturized, soft, and healthy.3. Variety of Flavors: EOS offers a wide range of appealing flavors, allowing users to choose their preferred scent and taste. This variety adds a pleasant and enjoyable element to the lip balm experience.4. Long-lasting Formula: The formula of EOS lip balms is designed to provide long-lasting moisture, reducing the need for frequent reapplication. This feature is particularly beneficial in dry or harsh weather conditions.5. Gluten-Free and Dermatologist-Tested: EOS lip balms are often gluten-free and undergo dermatologist testing, ensuring that they are safe for use and suitable for individuals with specific sensitivities or preferences.Overall, EOS lip balms stand out due to their innovative design, natural ingredients, variety of flavors, long-lasting formula, and commitment to quality and user satisfaction.

For more questions on Evolution

https://brainly.com/question/21202780

#SPJ8

Note: The correct question would be as

What are the key advancements and improvements in EOS (Evolution of Smooth) lip balms compared to traditional lip balms?

When recording euthanasia be sure to note the date, animal identification information, confirmed or tentative diagnosis, euthanasia method and

Answers

When recording euthanasia be sure to note the date, animal identification information, confirmed or tentative diagnosis, euthanasia method and final disposition.

The euthanasia record is an important document for veterinary practices and should be maintained according to state and federal regulations and the policies and procedures of your practice.

When recording euthanasia, be sure to note the date, animal identification information, confirmed or tentative diagnosis, euthanasia method, and final disposition.

Another important thing to note is that euthanasia should be considered only when alternative management options are not available or have been exhausted, when quality of life is poor, and when euthanasia is in the best interest of the animal.

All reasonable steps should be taken to minimize pain and distress during the process.

For more such questions on euthanasia

https://brainly.com/question/685938

#SPJ8

what might a clinician see in a karyotype showing a genetic disorder

Answers

Distinctive facial features, hope this helps :)
a clinician may see irregular chromosomes, missing or extra chromosomes

How are these emission spectrums different from an emissions from the sun or other stars

How are these emission spectrums different from an emissions from the sun or other stars

Answers

Answer:

the suns emission spectrum is colorful with black lines

Explanation:

The Sun’s spectrum is an absorption line spectrum, which is produced when continuous light from a hot source (the Sun’s interior) passes through a cooler cloud of gas (the gas that makes up the Sun’s visible surface). Notice that the Sun’s spectrum appears brightest (or most intense) in the yellow-green region.

How are these emission spectrums different from an emissions from the sun or other stars

After synapsis, chromosomes may swap segments in a process called translocation.
True
False

Answers

Answer:

false

Explanation:

During synapsis, chromatids of homologous chromosomes exchange segments in a process called crossing over. This rearranges genetic info. As this phase continues the chromosomes coil tightly and a spindle forms.

Residual parent material refers to the *weathered rock* and *soil* that remains in its place of origin, while *transported parent material* is material that has been carried and deposited by natural agents such as water, wind, or glaciers.

The impact of these different types of parent material on *soil formation* can be significant. Residual parent material tends to contribute to the formation of soils with characteristics similar to the parent rock. The weathering process breaks down the rock into smaller particles, allowing for the development of soil horizons and the release of minerals that influence soil fertility. In contrast, transported parent material can introduce a diverse range of materials to a given area, leading to variations in soil composition, texture, and fertility. The transportation process can mix different types of sediment, resulting in the formation of heterogeneous soils with varying properties.

Answers

Residual parent material is the rock and soil that is still located in its original location and is weathered. Transported parent material is material that is carried and deposited by natural agents such as water, wind, or glaciers. The effect of these different types of parent material on soil formation can be significant.

Residual parent material usually contributes to the development of soils with qualities similar to the parent rock. The breakdown of rock into smaller particles through weathering enables the formation of soil horizons and the release of minerals that influence soil fertility.

The physical and chemical characteristics of soils derived from this form of parent material are often similar and homogeneous, allowing for predictable fertility and properties. Transported parent material, on the other hand, can introduce a diverse range of materials to a given area, resulting in variations in soil composition, texture, and fertility.

The transportation process can blend different types of sediment, resulting in the formation of heterogeneous soils with different characteristics. Transported parent material can also be exposed to weathering processes, altering its original composition and resulting in soils with varying degrees of fertility.

While transported parent material can increase the diversity of soil properties in an area, it can also make it difficult to predict soil characteristics, particularly in areas where different types of sediment have been deposited. The relationship between parent material and soil development is complex, with both the initial characteristics of the material and the surrounding environment influencing soil properties.

In general, residual parent material contributes to the development of homogeneous soils with predictable properties, while transported parent material can result in more diverse and heterogeneous soils.

Know more about soil fertility here :

brainly.com/question/1189655

#SPJ8

An antelope population has a negative population growth rate. Which of the following conditions must also be true for the population growth rate to be negative?

a. births + deaths < immigrations + emigrations

b. births + deaths > immigrations + emigrations

c. births + immigrations < deaths + emigrations

d. births + immigrations > deaths + emigrations​

Answers

The antelope population has a negative population growth rate. So, the birth rate + immigration rate of the population will be less than the death rate and emigration rate. Thus, the correct option is C.

What is Population growth rate?

Population growth rate is the increase or decrease in the number of individuals in a population or a dispersed group. Population growth depends upon several factors which include:

1. Birth rate: It is the total number of new births in a population. It increases the population growth.

2. Death rate: It is the total number of deaths in a population. It decreases the population growth.

3. Immigration: It is the entry of new individuals through migration into a population. It increases the population growth.

4. Emigration: It is the removal or migration of individuals from a population. It decreases the population growth.

Thus, a population with negative population growth rate will have birth rate and immigration less than the death rate and emigration rate.

Therefore, the correct option is C.

Learn more about Population growth rate here:

https://brainly.com/question/14122627

#SPJ1

Women
.
.
.
.
.
.
..

Answers

Answer:

i agree?

Explanation:

women are incredibly poop and poop

Which of the following is NOT an essential part of turning nitrogen into a form usable by animals?A. Nitrogen fixing bacteriaB. Denitrifying bacteriaC. Nitrifying bacteria

Answers

The correct answer is B. Denitrifying bacteria. This bacteria convert nitrous compounds to molecular nitrogen, which is not usable for animals, it is only usable for certain type of bacteria.

the fundamental niche of g. fortis spans seeds from , and its realized niche from . g. fortis cannot feed on the seed types. additionally, it avoids feeding on the seed types as long as enough of the seed types are still available. this is consistent with the hypothesis that g. fortis initially avoids seeds in its fundamental niche that and hence make less energy available to them for the same amount of time spent feeding. 2) the fundamental niche of g. fuliginosa spans seeds from ; and its realized niche from . g. fuliginosa cannot feed on the seed types. additionally, it avoids feeding on the seed types as long as enough of the seed types are still available. this is consistent with the hypothesis that g. fuliginosa initially avoids seeds in its fundamental niche that and hence make less energy available to them for the same amount of time spent feeding.

Answers

1) 0.6-1.8 mm ; 0.8 - 1.8 mm; smallest ; largest ; medium; have a thick oat and take longer to crack

2) 0.2 - 1.0 mm; 0.2 - 0.7 mm; largest ; smallest ; medium; are small with little biomass per seed

The total collection of circumstances that allow an animal (population, species) to live and reproduce itself is referred to as its fundamental niche. Realized niche refers to the circumstances that a particular animal (population, species) really uses, after taking into consideration interactions with other species (predation, particularly competition).

The human niche serves as the setting for how people and their groups experience life. It is where we create and participate in shared knowledge, social and structural security, and growth over the lifetime, as well as where we share our social and ecological history.

Learn more about the fundamental niche

https://brainly.com/question/30050221

#SPJ4

Full Question: 1) The fundamental niche of G.fortis spans seeds from _______ , and its realized niche from _______. G. fortis cannot feed on the ______ seed types. Additionally, it avoids feeding on the ________ seed types as long as enough of the _______ seed types are still available. This is consistent with the hypothesis that G.fortis initially avoids seeds in its fundamental niche that ___________________________ and hence make less energy available to them for the same amount of time spent feeding.

2) The fundamental niche of G. fuliginosa spans seeds from ________ ; and its realized niche from_________. G. fuliginosa cannot feed on the ______ seed types. Additionally, it avoids feeding on the ________ seed types as long as enough of the ________ seed types are still available. This is consistent with the hypothesis that G. fuliginosa initially avoids seeds in its fundamental niche that __________________ and hence make less energy available to them for the same amount of time

Question 1 (5 points)
Write a biconditional statement for the following conditional statement.
If n is an even number, then it's divisible by 2.
If n is divisible by 2, then it's an even number.
If n isn't an even number, then it's not divisible by 2.
nis an even number if and only if it's divisible by 2.
2
If n is an even number, then it's not divisible by 2.

Answers

Answer:

n is an even number if and only if it's divisible by 2.

Explanation:

Biconditional statement is a type of statement which is only written when the both segments of the sentence are true. For writing biconditional statement, ''if and only if'' words should be used. For example, the two sides of the triangle are same if and only if both have same length. The biconditional statement considered as true if both the segments are true in nature. Symbolically, it is denoted by double arrows between two symbols.

DNA sequence of a particular gene is nine nucleotides long if the 31st nucleotide is deleted how many amino acids will the mutation likely impact in the gene

Answers

Answer:

dnx

Explanation:

lacreta miloco haichoo lade

Which person made the statement in the box upon becoming president in 1963?
Responses
A Lyndon B. JohnsonLyndon B. Johnson
B John F. KennedyJohn F. Kennedy
C George H.W. BushGeorge H.W. Bush
D Dwight D. Eisenhowe

Answers

The statement in the box was made by John F. Kennedy upon becoming president in 1963.

Kennedy was inaugurated as the 35th President of the United States on January 20, 1963, succeeding Dwight D. Eisenhower. His inaugural address was a call for national service and a call to action for all citizens to become involved in the affairs of their nation.

Kennedy's speech was one of the most memorable in American history and is widely considered one of the most important presidential speeches of the 20th century. In his address, Kennedy famously said, "Ask not what your country can do for you; ask what you can do for your country."

Learn more about Kennedy's speech at:

https://brainly.com/question/30159450

#SPJ1

Based on the understanding of the process of photosynthesis what are the strengths and weaknesses of this model

Answers

Answer:

The strength of the photosynthesis model is that it shows the complicated process that happens in different parts of the plant. However, a weakness of the model is that it oversimplifies the process and does not account for all of the factors that can affect photosynthesis, such as environmental conditions or plant genetics.

Other Questions
world war ii demonstrated that____A. the only way to get out of a deep depression was to go to war. B. fiscal policy was ineffective if the country went to war. C. fiscal policy was ineffective if the country went to war.D. fiscal policy was unnecessary if the country went to war. E. expansionary fiscal policy had the capability of creating jobs in the short run. What is the distance between the two points shown on the coordinate plane below? { -4-,3 } and {4,3 } 6 units 1 unit 8 units 12 units Please Help me with This Shonda painted 3 walls in her home. She used 3/4 of her paint. She used the same amount of paint on each wall.How much of her paint was used on each wall?Shonda used ____ of her paint on each wall.(A). 1/4(B). 9/4(C). 15/4 the method of market analysis advocated here reverses the usual logic in a market study: instead of focusing first on the larger world and then narrowing to the property, the approach here starts at the and examines the links to the larger world. Number 7 ;( I wish I was good at math I need help plz and thank you1 Please list and describe at least three advantages to working out with a partner.2. Please list and define at least three ways to keep yourself happy in a group setting while looking out for the needs of others.3. What is the definition and an example of a competitive game?4. What are the four stages of group building? Please explain each stage.5. Please list at least three ways that you can keep everyone involved in group fitness happy and feeling like they have an important role. S A pulse traveling along a string of linear mass density is described by the wave functiony = A e^(-bx) sin (kx - t)where the factor in brackets is said to be the amplitude.(c) Compute the ratio P(x) / P(0) what did the constitution replace as our governing document in the united states? this whole worksheet, im so tired i havent slept in two days ive had so much work please im begging yoj Which rights are guaranteed by the Bill of Rights? voting, holding office, choosing work freedom of speech, freedom of the press, freedom of religion life, liberty, the pursuit of happiness education, owning a business, traveling what would the molarity of the dichromate in the volumetric flash before it reactswith the fe (ii) in thesample? dexmethylphenidate has been prescribed to scott, a 7-year-old boy who was diagnosed with adhd. the mother asks how this medication will help her son. which would be the most accurate description of the purpose of this medication? A student is making a model of the famous Giza pyramid,which has four triangular sides and a square base. Thescale of the model is 1:1,000.How many sides should the model pyramid have?A. 6B. 4.C. 3D. 12 An analysis of the relationship between the sales volume and accounting profitability is called _____ analysis. Factor completely (x2 +x -6)(2x2 + 4x) Groups of muscles in the head direct the actions necessary for............a. chew and swallowb. to chew and to swallowc. being chewed and swallowingd. chewing and swallowing Please don't spam and answer correctly Thanks!How are gopher tortoises important to other species in their ecosystem? How would these other species be affected if the gopher tortoise became extinct? Michaela needs to represent this statement as an inequality.One-fourth of a number is no more than two-thirds.Drag and drop a symbol to correctly complete the inequality. a postsurgical patient is requesting hair care from the nurse. which information would the nurse document after hair care is performed