Answer:
the middle east region was not always a vast desert
Answer:
Explanation:
The most widely accepted theory for why the Middle East is loaded with oil is that the region was not always a vast desert. ... As the land in the modern Middle East region rose due to tectonic activity, the Tethys Ocean receded.
Name 2 body systems that interact to maintain
homeostasis in the human body and explain how they do
Answer:
Internal Temperatures
Similarly, the cardiovascular, integumentary (skin and associated structures), respiratory, and muscular systems work together to help the body maintain a stable internal temperature. If body temperature rises, blood vessels in the skin dilate, allowing more blood to flow near the skin's surface.
OR,
The nervous and endocrine systems exert the ultimate control over homeostasis because they coordinate the functions of the body's systems. Regulation of body temperature, blood pressure, pH, and glucose concentration are four examples of how the body maintains homeostasis.
Hope you know
I need help on this one
Answer:
high tides on both sides
Explanation:
the ocean bulges outwards
climate change storys
We pollute the environment with greenhouse gasses to the earth's climate is getting warmer
a scientist discovers a microbe with genetic material and proteins, but no nucleus or cell structures. what is the best conclusion about the microbe?
If a scientist discovers a microbe with genetic material and proteins but no nucleus or cell structures, then the best conclusion about the microbe is that it is a prokaryotic cell.
Prokaryotic cells are unicellular organisms that lack a nucleus and other membrane-bound organelles. Instead, their genetic material is contained within a single circular chromosome in the cytoplasm. They also lack internal membranes and have a simpler internal structure than eukaryotic cells.
Prokaryotic cells are able to perform all necessary life processes without the need for specialized organelles because they have all the necessary proteins within the cytoplasm. The genetic material contains the information necessary to produce these proteins. Thus, the presence of proteins within the microbe is not surprising, but the lack of membrane-bound organelles is characteristic of prokaryotic cells.
In conclusion, the best conclusion about the microbe is that it is a prokaryotic cell, which lacks a nucleus and other membrane-bound organelles, but contains genetic material and proteins in the cytoplasm.
To know more about microbe visit:
https://brainly.com/question/30450246
#SPJ11
"Brain tissue is made up of grey matter and what other type of matter?"
Brain tissue is made up of two types of matter: grey matter and white matter. Grey matter contains the cell bodies, dendrites, and axon terminals of neurons, while white matter consists of myelinated axons that are responsible for transmitting signals between different parts of the brain.
The white matter gets its name from the fatty substance that surrounds the axons, called myelin, which gives the tissue its white appearance. Together, grey and white matter work together to ensure proper brain function, with grey matter processing and analyzing information and white matter providing the means for communication and connection between different areas of the brain. This complex interplay of brain tissue is crucial for a wide range of cognitive and physiological processes, from perception and emotion to movement and memory.
Learn more about myelin here:
https://brainly.com/question/28044185
#SPJ11
following intense exercise, the human body attempts to overcome oxygen debt by
Following intense exercise, the human body attempts to overcome oxygen debt by increasing respiration rate and heart rate.
What is oxygen debt? Oxygen debt is the amount of oxygen required to restore a muscle to its pre-exercise condition. It's the amount of oxygen that a person's body needs to get back to a resting state after an intense workout. When a person participates in intense exercise, their body is unable to provide the muscles with enough oxygen to keep up with the demand. This oxygen debt is the difference between the amount of oxygen needed by the body to perform exercise and the amount of oxygen consumed by the body during exercise.What happens after intense exercise?When intense exercise is performed, oxygen is consumed by the body at a faster rate than it is supplied, resulting in an oxygen deficit. The body responds to this deficit by raising respiration and heart rates to provide more oxygen. This is due to the fact that the body needs to generate more energy to meet the increased demands of exercise. After exercise, the body continues to demand extra oxygen to eliminate lactic acid, which is a byproduct of anaerobic respiration that causes muscle fatigue. By increasing respiration and heart rates, the body may continue to consume additional oxygen to address oxygen debt.
To know more about respiration , visit
https://brainly.com/question/22673336
#SPJ11
The primary function of the kidney is to exchange molecules across a membrane between the blood and the urine. One type of kidney cell has a basic rectangular shape, except for a single surface, which is lined with tiny, finger-like projections that extend into the surrounding extracellular space. Which of the following best explains the advantage these projections provide the cell? The projections increase the volume of the cell without affecting the surface area, which increases the metabolic needs of the cell. B The projections increase the surface area-to-volume ratio of the cell, which allows for more efficient nutrient exchange with the environment. The projections increase the speed at which an individual molecule can move, resulting in faster nutrient Which of the following best explains the advantage these projections provide the cell? A The projections increase the volume of the cell without affecting the surface area, which increases the metabolic needs of the cell. B The projections increase the surface area-to-volume ratio of the cell, which allows for more efficient nutrient exchange with the environment. The projections increase the speed at which an individual molecule can move, resulting in faster nutrient exchange with the environment D The projections increase the selectivity of the membrane because the small size of the projections limits the number of transport proteins that can be embedded in the membrane.
Answer:
The answer is B: The projections increase the surface area-to-volume ratio of the cell, which allows for more efficient nutrient exchange with the environment.
Explanation:
These finger-like projections, also known as microvilli, are commonly found in cells that are actively involved in absorption or secretion, such as the kidney cells in this scenario. They significantly increase the surface area of the cell, thereby allowing more transport proteins to be embedded in the cell membrane and facilitating more efficient exchange of molecules between the cell and its environment. This increase in surface area doesn't significantly affect the volume of the cell, so it doesn't considerably increase the metabolic needs of the cell.
Therefore, these projections do not primarily increase the volume of the cell (option A), the speed of individual molecule movement (option C), or the selectivity of the membrane by limiting the number of transport proteins (option D). Instead, they enhance the cell's capacity for molecular exchange by increasing its surface area.
some antibiotics, for example streptomycin, block protein synthesis in bacteria, but not in eukaryotes. mitochondria and chloroplast contain their own protein synthesis machinery. would you expect streptomycin to block mitochondrial protein synthesis? explain your answer.
Yes, streptomycin can block mitochondrial protein synthesis. This is because mitochondria and chloroplasts are believed to have originated from ancient prokaryotic cells through endosymbiosis. As a result, their protein synthesis machinery closely resembles that of bacteria.
Streptomycin specifically targets the 30S ribosomal subunit in prokaryotic cells, blocking protein synthesis by interfering with the initiation and elongation process. Since mitochondrial ribosomes share similarities with prokaryotic ribosomes, streptomycin can also bind to the mitochondrial 30S subunit, inhibiting protein synthesis within the organelle.
However, it is important to note that streptomycin's effect on mitochondria is usually not as detrimental to eukaryotic cells, as they have additional protein synthesis machinery in the cytoplasm that can compensate for the disrupted mitochondrial protein synthesis. Nonetheless, the antibiotic's impact on mitochondrial function can still cause side effects in eukaryotic organisms.
To know more about Mitochondria visit :
https://brainly.com/question/14740753
#SPJ11
1. The rate of growth of a certain bacteria B, in a petri dish is proportional to the number of S, is inversely proportional to the square of bacteria in the dish.
The rate of growth of a certain bacteria B, in a petri dish is proportional to the number of S, is inversely proportional to the square of bacteria in the dish is Directly proportional.
In mathematics, there are two ways that quantities are proportional to each other. One of those methods is when their magnitudes are directly proportional. This means that there is a constant of proportionality.
k
he makes a statement
j
=
k
X
Be true. The growth rate of a particular bacterium B in a petri dish is proportional to the number of S and inversely proportional to his squared number of bacteria in the petri dish.
Read more about bacteria;
https://brainly.com/question/28914719
#SPJ4
Which process copies an organism's DNA?
A mutation
B replication
C transcription
D translation
Answer:
I think it's is B. replication
Answer:
replication is the process copies an organisms DNA
What causes the tectonic plates to move convenon Currents in the mante b) the dynamo effect created in the core e electre currents produced in the core d) solar flares
in a water molecule the hydrogen and oxygen atoms hold together by sharing
Answer:
covalent bonds.
Explanation:
Covalent bonds happen when two atoms - in this case, hydrogen and oxygen - share electrons with each other.
Answer:
covalent bonds
Explanation:
duh
In order to balance on one foot, many people need to have their eyes open. This is an example of:
A.motion parallax.
B.sensory interaction.
C.vestibular sense.
D.perceptual maladaptation.
In order to balance on one foot, many people need to have their eyes open. This is an example of: B. sensory interaction.
Sensory interaction refers to the way in which different sensory systems work together to create a complete perception of the world around us. In the case of balancing on one foot, the visual system works in conjunction with the proprioceptive system (which tells us where our body parts are in relation to one another) and the vestibular system (which helps us maintain our balance and spatial orientation).
When we close our eyes, we lose the visual information that we rely on to help us balance. This can make it more difficult to maintain our balance because our sensory systems are no longer working together as effectively. In other words, sensory interaction is disrupted.
The other answer choices are not correct for this question. Motion parallax refers to the way in which objects appear to move relative to each other as we move our bodies. It is not directly related to balancing on one foot. The vestibular sense is involved in balancing, but it is not the only sense involved. Perceptual maladaptation refers to a situation in which our perception of the world around us is inaccurate or distorted due to prolonged exposure to a particular stimulus, and it is not directly related to balancing on one foot.
To know more about Sensory interaction visit:
https://brainly.com/question/31933122
#SPJ11
The concave surface of the lungs where blood vessels, lymphatic vessels, nerves and the primary bronchi enter and leave contains a slit. This slit is called the ______.
The concave surface of the lungs where blood vessels, lymphatic vessels, nerves and the primary bronchi enter and leave contains a slit called the HILUM. It is also known as the root region.
The hilum (root region) is the point at which bronchi, pulmonary arteries and pulmonary veins enter into the lung.
Each hilum (left and right) has a pulmonary artery, pulmonary veins, and bronchial arteries.
The hilum or root region connects the lungs to supporting structures where pulmonary vessels enter and exit the lungs.
Learn more in:
https://brainly.com/question/7138725
Lactose is found in milk products. It is converted by the body into a usable form in a series of chemical reactions. The diagram shows the series of reactions that convert lactose into a usable form.
Responses
Each enzyme is specific to its substrate.
Each enzyme is specific to its substrate.
The equilibrium of the reaction is maintained.
The equilibrium of the reaction is maintained.
The reaction rate decreases.
The reaction rate decreases.
The enzyme will be broken down for energy.
The enzyme will be broken down for energy.
Lactose is found in milk products. It is converted by the body into a usable form in a series of chemical reactions. The diagram shows the series of reactions that convert lactose into a usable form. The appropriate response will be Each enzyme is specific to its substrate.
What is an enzyme?Enzymes are described as proteins that act as biological catalysts by accelerating chemical reactions.
There are several factors that cause an enzyme to be denatured; one of them is an increase in temperature.
So, when enzyme II is denatured, its molecular structure changes, and it In conclusion, the galactose increases when enzyme II is denatured.
Learn more about an enzyme at:
https://brainly.com/question/1596855
#SPJ1
Why a Theory Is Also a Hypothesis
Answer:
In scientific reasoning, a hypothesis is an assumption made before any research has been completed for the sake of testing. A theory on the other hand is a principle set to explain phenomena already supported by data. In scientific reasoning, a hypothesis is constructed before any applicable research has been done.
Does the youth service project or
civis organisation help the community
Answer:
ya the youth service project or
the youth service project or civis organisation help the community
The_____pattern of growth is the sequence in which growth starts at the center of the body and moves toward the extremities.
The proximodistal pattern of growth is the sequence in which growth starts at the center of the body and moves toward the extremities.
What is the growth pattern where development starts at the body's center and extends to the extremities?The proximodistal pattern of growth refers to the sequential process of growth and development in which growth begins at the core or center of the body and gradually extends outward towards the extremities.
During prenatal development, this pattern is observed as the body's major structures and organs form before the limbs and digits.
In infancy and childhood, this pattern continues as the central nervous system, spinal cord, and major skeletal structures develop first, followed by the growth of the arms, legs, hands, and feet.
Learn more about sequential process
brainly.com/question/32247272
#SPJ11
How would you draw a DNA molecule that is 10 nucleotides in size?
Answer:
Explanation:
Adenine an Guanine are purines while cytosine and thymine are pyrimidines.
According to Chargaff's rule, the ratio of purines to pyrimidines is equal.
Thus, the number of cytosine (C) will be equal to the number of guanine (G).
As it is given that the number of guanine-containing nucleotides = 410
Thus, G = C = 410
Now, G + C = 410 + 410 = 820
The number of adenine (A) will be equal to the number of thymine (T).
Thus, A + T = Total number of nucleotides – Nucleotides containing G and C nitrogenous bases
= 1500 – 820 = 680
Therefore, A = 340 and T = 340
The number of adenine will be equal to number of thymine, which is 340.
Therefore, Number of pyrimidines that the segment possess = C + T
= 410 + 340 = 750
Which process turns glucose into energy?
Breathing
Cell division
Cellular respiration
Photosynthesis
Answer:
cellular respiration
Explanation:
Which is part of the repair process to heal a broken bone?
Answer:
There are three stages of bone healing: the inflammatory, reparative, and remodeling stages.
Explanation:
Hematoma Formation (Days 1 to 5)
Fibrocartilaginous Callus Formation (Days 5 to 11)
Bony Callus Formation (Days 11 to 28)
Bone Remodelling (Day 18 onwards, lasting months to years)
These are the four stages of bone healing.
HOPE IT HELPS
Identily human activities that lead to deforestation Select as many that apply
A dearing land for farms and pastures
B. planting trees in city parks
C. ercion caused by hurricane winds and storm surge
D. building roads, and houses
Answer:
D. Building roads and houses
Explanation:
Hope this helps :)
List 2 examples of how bacteria are necessary for other species to exist.
Bacteria are necessary for other species to exist.
1. Helps in breaking down food- there are certain species of bacteria that reside in the gut of animals which helps in maintaining the conditions necessary for digesting food.
2. Fix atmospheric nitrogen- some bacteria live on the root nodules of specific plants that help in the nitrogen fixation which can be absorbed by the plants that act as a fertilizer.
what are crows scared of
Answer:
Rattling and clanging sounds deter crows as much as reflected light. Distress signals. Play recorded distress calls of other crows to keep them at bay. Noisemakers and the sounds of fireworks are also a repellent.
Explanation:
TRANSLATE the mRNA sequence below into an amino acid sequence
using your preferred codon chart. Type the ONE-LETTER CODES FOR
AMINO ACID SEQUENCE AS YOUR ANSWER. DO NOT use dashes or
anything else to separate your letters.
Type the amino acid sequence you get as your answer. *Use the 1-letter codes for
the amino acids* DO NOT PUT SPACES, DASHES, OR COMMAS BETWEEN THE
LETTERS!! NOTE: The amino acids should spell a WORD if done correctly.
mRNA AACAUGAUGGCCAAAGAGUAAGCCA
METHIONINE-VALINE-ALANINE-PROLINE-LYSINE-SERINE-ALA is the amino acid sequence that is encoded by the mRNA sequence AACAUGAUGGCCAAAGAGUAAGCCA.
Thus, the method through which the genetic material contained in an mRNA sequence is utilized to create a protein. Codons, which stand for groups of three nucleotides that denote certain amino acid sequence, are read from the mRNA sequence.
The start codon, AUG, initiates the production of proteins and codes for the amino acid methionine. The remaining amino acids in the sequence are then encoded by the following codons in the mRNA sequence. The shape and function of the protein that is eventually formed are greatly influenced by the resultant amino acid sequence.
Learn more about the amino acid sequence here:
https://brainly.com/question/13266141
#SPJ1
What are 3 examples of how enzymes work
Answer:
Amylase – helps change starches into sugars. ... Maltase – also found in saliva; breaks the sugar maltose into glucose. Maltose is found in foods such as potatoes, pasta, and beer. Trypsin – found in the small intestine, breaks proteins down into amino acids.
Explanation:
Bacteria add carbon to the carbon cycle by (1 point)
O being consumed by larger organisms, such as plankton.
O decomposing dead organisms.
exchanging carbon dioxide and oxygen gases
O performing photosynthesis.
Bacteria and the carbon cycle have an important link, to understand this link we need to know that.....
The carbon cycle
The carbon cycle is constituted by the absorption of carbon dioxide by plants in the process of photosynthesis. Half of this absorbed carbon is released into the atmosphere and the other half the plant uses to produce sugars (glucose). When ingesting plants, animals ingest carbon together for their organism, being released through respiration or its decomposition.
Bacteria add carbon to the carbon cycleFungi and bacteria are responsible for the decomposition of both
Animals and PlantsThey ingest part of this carbon, releasing it to the atmosphere and the soil.
With this information, we can say that bacteria add carbon to the carbon cycle by decomposing dead organisms.
Decomposers, such as bacteria, are extremely important, because without them the carbon cycle would not be complete.
Learn more about carbon cycle in https://brainly.com/question/1627609?referrer=searchResults
Blood pumps through arteries due to contraction of the arterial walls but flows more freely through veins because there is little to no contraction. Based on this information, which would you expect to be present in higher quantities in arteries than in veins
Excitable cells like those found in muscle tissue are expected to be present in higher quantities in arteries than in veins.
What are Excitable cells?Excitable cells are defined as those cells that are capable of generating electrical impulses when stimulated. Example of such cells include:
Neurons,muscle cells( smooth, skeletal and cardiac)Endocrine cells.The artery is made up of higher amount of smooth muscles than the veins therefore, excitable cells like those found in muscle tissue are expected to be present in higher quantities in arteries than in veins.
Learn more about muscles here:
https://brainly.com/question/25778330
#SPJ1
Compare and contrast semidiurnal tides, mixed semidiurnal tides and diurnal tides.
It is called a semi-daily or semidiurnal tidal pattern when the heights of the two highs and lows are roughly equal whereas a mixed semidiurnal tidal pattern is one in which the heights of the high and low tides vary. It is called a diurnal tide when areas have only one high and one low tide each day.
Since "diurnal" refers to a daily occurrence, a tide is said to be diurnal if there is just one whole tidal cycle every day. In the Gulf of Mexico, on Alaska's west coast, and in some regions of Southeast Asia, diurnal tides are typical.
Semidiurnal refers to "half of a day," and as one tidal cycle lasts for half a day, there are two full cycles per day. The majority of Europe, the west coast of Africa, the east coast of North America, and Australia all experience semi-daily tides.
The differences in height in mixed semidiurnal tides may be the result of amphidromic circulation, the angle of the moon, or any of the other variables. They are found along the Pacific coast of North America.
Learn more about what causes tides here: https://brainly.com/question/11545040
Why are cells considered the basic unit of life
Answer:
a cell is the smallest unit of a living thing
Explanation:
cells are the building blocks of all organisms