why did you make the attribution you made in the beginning of the chapter? what type of attribution was this? what potentially caused you to make each attribution?

Answers

Answer 1

We make attribution in the beginning of chapter as In social psychology, attribution is the process of concluding the causes of events or actions.

The type of attribution it was attribution is commodity we all do every day, generally without any mindfulness of the underlying proceedings and impulses that lead to our consequences.

The cause of attribution is that it is a process of commissioning the cause of geste to some situation or happening outside a person's regulator rather than to some inward specific. When we try to clarify our own geste we tend to make extrinsic attributions, similar as situational or terrain features.

What are the causes of attribution errors?

The introductory attribution error exists because of how people feel the world. While you have at least some exemplar of your character, provocations, and situational attorneys that affect your day- to- day, you infrequently feel everything that is going on with someone differently.

What's the significance of attribution?

Attribution theory is significant for associations because it can help directors understand some of the reasons of hand geste and can help workers in understanding their thinking about their own actions.

Learn more about Attribution :

brainly.com/question/6654060

#SPJ4


Related Questions

Importance of Shay’s Rebellion

Answers

Answer: Was one of the major influences in the calling of a Constitutional Convention in Philadelphia.

Explanation:

One of the major influences

which of the following are relations-oriented leadership behaviors? check all that apply.

Answers

The relations-oriented leadership behaviors among the given options are:

A. Encouraging an employee who is having trouble completing a task

B. Talking with an employee about her career plans.

Leadership is the ability to inspire and guide others towards a common goal or vision. It involves making sound decisions, motivating team members, and fostering an environment of collaboration and growth. A leader sets the direction and provides a sense of purpose, effectively communicating expectations and objectives to their team. They possess strong interpersonal skills, actively listening to their team members, understanding their strengths, and empowering them to reach their full potential.

A leader leads by example, demonstrating integrity, resilience, and adaptability. They embrace challenges and guide their team through obstacles, providing support and guidance along the way. A leader also encourages innovation and creativity, fostering an environment where ideas can be shared and nurtured. They inspire trust and build strong relationships, recognizing and celebrating the contributions of their team members.

To know more about Leadership refer to-

brainly.com/question/32010814

#SPJ4

The relations-oriented leadership behaviors among the given options are:

A. Encouraging an employee who is having trouble completing a task

B. Talking with an employee about her career plans.

Leadership is the ability to inspire and guide others towards a common goal or vision. It involves making sound decisions, motivating team members, and fostering an environment of collaboration and growth. A leader sets the direction and provides a sense of purpose, effectively communicating expectations and objectives to their team. They possess strong interpersonal skills, actively listening to their team members, understanding their strengths, and empowering them to reach their full potential.

A leader leads by example, demonstrating integrity, resilience, and adaptability. They embrace challenges and guide their team through obstacles, providing support and guidance along the way. A leader also encourages innovation and creativity, fostering an environment where ideas can be shared and nurtured. They inspire trust and build strong relationships, recognizing and celebrating the contributions of their team members.

To know more about Leadership refer to-

brainly.com/question/32010814

#SPJ4

After the death of his father, jimmy carter decided to follow in his fathers footsteps. Explain what jimmy did to make this happen.

Answers

James Earl Carter Sr. was an effective businessman, farmer, and member of the community politics. He was Jimmy Carter's father. Following in his father's footsteps and pursuing a career in business and politics after his father's death, Jimmy Carter made the decision.

A person is a businessperson if they established the businessman , own it, or have ownership interests in it even as an angel investor.

A businessperson engages in commercial or industrial activities to generate cash flow, sales, and revenue employing a combination of human, financial, Jimmy Carter's intellectual, and physical capital with the goal of promoting economic development and growth.

Learn more about businessman, from :

brainly.com/question/887012

#SPJ1

What were the three ways that WWI laid “fertile ground” for the Holocaust?
What was Hitler’s first attempt at a power grab in Germany?
How did Hitler’s arrest, trial, and prison sentence change his beliefs about how to win control of Germany?
What were the economic conditions in the Weimar Republic after WWI?

Answers

Adolf Hitler, the leader of the National sozialistische Deutsche Arbeiterpartei (NSDAP), General quartiermeister Erich Ludendorff, and other Kampfbund leaders attempted a failed coup d'état in Munich, Bavaria, on November 8–9, 1923, during the Weimar Republic.

Who was Hitler?

German politician Adolf Hitler, who was born in Austria, ruled Germany as its dictator from 1933 until his death in 1945. He became the chancellor in 1933 and the Führer und Reichskanzler in 1934 when the Nazi Party's leader grew to prominence. He invaded Poland on September 1, 1939, starting World War II in Europe during his rule.

Throughout the war, he participated actively in military operations and played a key role in the Holocaust, which resulted in the murder of millions of other people in addition to the approximately six million Jews.

To learn more on Hitler from the link:

https://brainly.com/question/354087

#SPJ1

educating athletes and exercisers about the harmful effects of drug use usually deters what percentage of people from using drugs?

Answers

Educating athletes and exercisers about the harmful effects of drug use can significantly deter people from using drugs.

Studies have shown that up to 70% of people can be deterred from using drugs after being educated about the harmful effects. This is because many athletes and exercisers value their physical health and understand that drug use can have negative consequences on their bodies and athletic performance.

Furthermore, education can help athletes and exercisers make informed decisions about their health and performance goals, and help them avoid the risks associated with drug use. It is important for coaches, trainers, and educators to continue to provide education and resources about the harmful effects of drug use to ensure that athletes and exercisers can make informed decisions about their health and well-being.

To learn more about athletes  click here

brainly.com/question/14915007

#SPJ11

What groups were symbols of cleanliness in the caste system? plz help this is due tomorrow :(

Answers

Answer:

The image shows the highest level to the lowest level

A Further Explanation:

Priests

Kings/rulers, warriors

Merchants, craftsmen, ect.

Farmers, servents

street sweepers, waste cleaners, and people who deal with dead bodies

What groups were symbols of cleanliness in the caste system? plz help this is due tomorrow :(

What is meant by multiple use when discussing natural resource policy?
A) Natural resources should be managed in a way that encourages economic development but also protects the environment.
B) Natural resources must be used multiple times before being disposed of.
C) One regulatory policy should cover multiple natural resources, such as wetlands, fossil fuels, timber, and others.
D) Economic development should use multiple natural resources

Answers

Multiple use when discussing natural resource policy refers to the concept that natural resources can be used for various purposes such as recreation, grazing, wildlife, and timber while protecting the environment. , the correct option is A).

This concept is embodied in the National Forest Management Act (NFMA) of 1976, which mandates that national forests and grasslands be managed for multiple uses and benefits that will provide a range of products and services such as timber, outdoor recreation, grazing, fish and wildlife, and more.

Therefore, the correct option is A) Natural resources should be managed in a way that encourages economic development but also protects the environment.

to know more about wildlife visit :

https://brainly.com/question/27180478

#SPJ11

Cite the Scriptural reference of the quoted verse: _____
"A man rejoices in giving the right answer, and a word spoken at
the right time-how good it is!"

Answers

Answer:

quoted verse: Proverbs 25:23

one complicated aspect of congressional elections is the allocation of seats in the house of representatives to each state after a census. what is this known as?

Answers

The distribution of seats in the house of representatives to each state following a census is a challenging part of the congressional election process. It is referred to as reapportionment.

Reapportionment is the procedure used to transfer seats among the states in the House and redesign congressional districts. Every ten years, when census results reveal changes in district populations, reapportionment is carried out. There must be an equal number of residents in each district.

By utilizing census data to build each parliamentary district evenly, reapportionment achieves this. Following the census, reapportionment is done every ten (10) years. To guarantee that all citizens are equitably represented, the Commission will analyze the demographic distribution and redraft the political districts.

To learn more about reapportionment

https://brainly.com/question/520295

#SPJ4

A lot of ballot papers/votes in nepalese elections are invalid.Explain any three reasons of that and any four ways to control it​

Answers

The reasons of invalid a lot of ballot papers/votes in the elections are the ballot paper is not officially produced, the ballot paper is valid for a different constituency and the ballot paper contains no markings.

What is election?

An election is a formal collective decision-making process in which a population chooses one or more people to hold public office. Elections have traditionally been the primary vehicle through which contemporary representative democracy has functioned.

A vote in a political election is thus deemed illegitimate when:

The ballot paper is not generated on an official basis.The ballot paper is only valid for one constituency.The ballot paper has no marks whatsoever; the voter's purpose is not obvious from the ballot paper; and the ballot contains extra, excess entries by the voter.The ballot paper is purposefully soiled by the voter.

Therefore, it can be concluded that Many ballot papers and votes in Nepalese elections are invalid.

Learn more about election here:

https://brainly.com/question/11184657

#SPJ1

6
Select the correct text in the passage.
Which sentence in this excerpt from Eleanor Roosevelt's speech "What Libraries Mean to the Nation" is an emotional appeal to the audience?
I know one place in the northern part of the state where I camped for a while in the summer, and I went to the school and talked to the teachers. They are using school books which have been passed down from one child to another. They have practically no books outside of the textbooks. The children in the district are so poor and some of them so pathetic that I suppose the struggle to live has been so great you could not think much about what you fed the mind, but I came away feeling that right there, in one of the biggest and richest states in the country, we had a big area that needed books and needed libraries to help these schools in the education of the children, and, even more, to help the whole community to learn to live through their minds.
We are doing a tremendous amount through the home economics colleges to help people to learn how to live in their homes, to better their standards of material living. We have got to think in exactly the same way about helping them to live mentally and to attain better standards, and we can do it only through the children. We can do ground work with the children; we must begin with them; but we have got to do a tremendous amount with the older people.

Answers

It's the long passage that starts, "The district's youngsters are so destitute, and some of them are so pitiful..."

The district's students are so underprivileged and some of them are so pitiful that I suppose the struggle to survive has been so great that you could not think much about what you fed the mind.

However, I left with the impression that there, in one of the largest and richest states in the nation, we had a large area that needed books and libraries to aid these schools in the education of the students and, more importantly, to aid the entire community in learning to live through their minds.

After reading the speech extract, we can identify the passage where Eleanor Roosevelt uses her word choice to elicit an emotional response. She is attempting to arouse sympathy and worry in her audience by describing the kids' living conditions, how miserable and pitiful they are, and how difficult it is for them to survive.

Roosevelt then goes on to explain the importance of libraries in those areas because education could help to improve the terrible situation. She is successful in relating the audience's feelings to the answer.

To learn more about Eleanor Roosevelt

https://brainly.com/question/370460

#SPJ9

can someone help me write a summary of the macedonian dynasty

In the second period of Byzantine history, the empire reached its peak. This second period fell during the Macedonian dynasty (867-1057). After an age of contraction, the empire expanded again and in the end, almost every Christian city in the East was within the empire's borders. On the other hand, wealthy Egypt and large parts of Syria were forever lost, and Jerusalem was not reconquered. In 1014 the mighty Bulgarian Empire, which had once been a very serious threat to the Byzantine state, was finally overcome after a bloody war, becoming part of Byzantium. The victorious emperor, Basilius I, was surnamed Boulgaroktonos, "slayer of Bulgars." The northern border was now finally secured and the empire flourished. Throughout this whole period the Byzantine currency was the leading currency in the Mediterranean world. It was a stable currency ever since the founding of Constantinople.

Answers

Answer:

The Byzantine Empire achieved its pinnacle during the second phase of its history, which covered the years 867 to 1057 and was ruled by the Macedonian dynasty. The empire began to expand again during a time of collapse, and it was able to reclaim nearly all of the Christian cities in the East. The empire lost wealthy Egypt and huge areas of Syria, but Jerusalem remained under enemy control. The mighty Bulgarian Empire, which had formerly posed a major threat to the Byzantine state, was finally absorbed into the Byzantine Empire in 1014 after a bloody conflict. Basilius I, the victorious emperor, was even granted the title "Boulgaroktonos," which means "slayer of Bulgars." A prosperous age began with the security of the empire's northern border.From Constantinople's establishment, the Byzantine money had remained stable and was at this time the most widely used in the Mediterranean region.

Explanation:

Answer:

the Macedonian dynasty ruled the Byzantine empire from 867 to 1056 following the Amorian dynasty. during this period,the Byzantine state reached it'sgreatest extents since the Muslim conquests and the Macedonian renaissance in letters and arts began. the Macedonian dynasty was characterised by a cultural revival in spheres such as philosophy and the arts.

standpoint theory is concerned with how society norms function in the world.T/F

Answers

False. Standpoint theory is not concerned with how society norms function in the world. Rather, standpoint theory focuses on the social and epistemological implications of different social positions or standpoints within society.

It explores how one's social location, such as their gender, race, class, or other aspects of identity, influences their perspectives, knowledge, and understanding of the world.

Standpoint theory argues that individuals situated in marginalized or oppressed positions have unique insights and knowledge that can challenge dominant perspectives and reveal hidden power structures. It asserts that our social positions shape our experiences and shape the way we understand and interpret the world.

In summary, standpoint theory is not primarily concerned with the functioning of societal norms but rather with the influence of social positions on individuals' perspectives and knowledge.

learn more about society norms here

https://brainly.com/question/28498578

#SPJ11

Which of these best describes the conquistadors?


A

polite


B

intrusive


C

appreciative


D

humble

Answers

Answer: Appreciative! <3

Explanation:

what was the compromise of 1877 and do you think it was a fair or unfair deal and why?

Answers

Answer:

The Compromise of 1877 was an agreement that resolved the disputed 1876 presidential election between Democratic candidate Samuel Tilden


i will give brainliest too the first person with reasoning

i will give brainliest too the first person with reasoning

Answers

Answer: it’s C network of land and sea.

Explanation:

It was a way people from Asia traded

NEED HELP ASAP !!!!!!!!!!!!!!!!!!!! In which area(s) did the Union appear to have the advantage entering the war? Explain your reasoning in 2-3 sentences. *Do not copy from anywhere please or I will fail :( *

Answers

The North was a better economic than the South did. So with that being said North had gotten more troops too fight the war. The North had gotten railroads, steamboats, roads, and canals for the faster transportation situation such for the supplies and troops. The Union has better advantages. but the south had a few.



i hope this helps! and you won’t fail if jus change up sum of the words:)

Raquel's mother is very tall and comes from a family in which almost everyone is above average in height. Raquel's father is quite short and comes from a family where almost everyone is below average in height. We would expect that Raquel will be of ______ height because the genes that affect height relate in a(n) ______ pattern.

Answers

Answer:

1. Average

2. Additive

Explanation:

Additive genes is a biological term that describes the condition at which genes in individuals specifically offspring are developed.

Additive genes are considered to developed when the dominant forms of both genes are present together and produce double effect.

In other words, additive genes is shown when two or more genes produce a single contribution to the final phenotype, such that, their combined effects equal the sum of their individual effects.

Hence, in this case, considering the combination of genes from someone whose family is above average in height with another person whose family is below average in height. Thus, it is expected that the offspring produce will be of AVERAGE HEIGHT, because the genes that affect height relate in an ADDITIVE pattern.

in maslow's hierarchy of needs, lower-order needs differ from higher-order needs as higher-order needs:group of answer choicesfocus on desires for psychological development and growth.focus on desires for physical and social well-being.focus on desires for good-interpersonal relationships.are addressed by things such as physical comfort on the job and reasonable work hours.are served by job security and adequate compensation and benefits.

Answers

The accurate statement regarding the difference between lower-order needs and higher-order needs in Maslow's hierarchy of needs is higher-order needs focus on desires for psychological development and growth. Option a is correct.

Maslow's hierarchy of needs is a theory that suggests individuals have a hierarchy of needs that must be fulfilled in a specific order. Lower-order needs, also known as basic or physiological needs, include necessities like food, water, shelter, and safety.

Higher-order needs, on the other hand, involve psychological and self-fulfillment needs. These needs encompass desires for personal growth, self-esteem, self-actualization, and fulfilling one's potential. They are focused on psychological development and growth, going beyond the basic physical and social well-being that lower-order needs address.

Therefore, option a is correct.

Learn more about hierarchy of needs https://brainly.com/question/29495620

#SPJ11

If you invested $500 and made $50 on the Investment, what is your rate of return?
O $50
O 10%
O $550
50%

Answers

Answer:

10%

Explanation:

You got 10% of the original investment back

500x10%=50

sociology of everyday life what does butler's theory of gender imply about the priority of categories that we take as natural and normal

Answers

Everyday life sociology has had influence outside its arena, stimulating grand theorists to create various micro-macro syntheses.

What is an example of sociology in everyday life?Everyday life sociology comprises a broad spectrum of micro perspectives: symbolic interactionism, dramaturgy, phenomenology, ethnomethodology, and existential sociology. We discuss the underlying themes that bind these diverse subfields into a unified approach to the study of social interaction. We outline the historical development of everyday life sociology, indicating the individuals, ideas, and surrounding context that helped to shape this evolving theoretical movement. We then examine three contemporary developments in everyday life sociology that represent significant theoretical, substantive, and methodological advances: existential sociology, the sociology of emotions, and conversation analysis. Within these areas, we outline major themes, review recent literature, and evaluate their contribution to sociology. We consider these and their relation to the everyday life themes. We conclude by discussing the major critiques and assess the future promise and problems of this perspective.

To learn more about sociology refer to:

https://brainly.com/question/3927775

#SPJ4

What major military victory did Sir Franics Drake help accomplish?
a
The defeat of the Spanish Armada
b
The defeat of the Dutch Armada
С
The defeat of the French navy
0
The victory of the battle of Hastings

Answers

A) The defeat of the Spanish Armada is correct :)

Q.62. Explain the baxriers to communication ? Give the suggestions to overcome these barxiers.

Answers

Barriers to communication can hinder the effective exchange of information and ideas. Some common barriers include language barriers, cultural differences, physical distractions, and emotional or psychological barriers.

To overcome these barriers, individuals can:

Improve language skills: Enhance language proficiency to ensure clear and accurate communication.Increase cultural awareness: Learn about different cultures and their communication styles to promote understanding and respect.Active listening: Pay attention to the speaker, show interest, and engage in active listening techniques such as paraphrasing and asking clarifying questions.

Feedback and clarification: Seek feedback, ask for clarification, and encourage open communication to address misunderstandings promptly.

By employing these strategies, individuals can mitigate barriers to communication and foster effective and meaningful interactions.

Learn more about communication:

https://brainly.com/question/33014927

#SPJ4

1. Define organisational behaviour.
2. "OB is for everyone" Build an argument to support this statement
3. Why is job satisfaction an important consideration for OB ?
4. Can empowerment lead to greater Job satisfaction?
5. What is an organisation? Is the family unit and organisation? Explain

Answers

Organizational behavior (OB) is the study of human behavior within organizations and how it influences individual, group, and organizational outcomes. It encompasses various disciplines such as psychology, sociology, anthropology, and management. OB examines topics such as motivation, leadership, communication, decision-making, teamwork, and organizational culture to understand how individuals and groups interact within the organizational context.

"OB is for everyone" - Argument:

Organizational behavior is relevant and beneficial for individuals at all levels within an organization. Here are a few arguments to support this statement:

a. Individual Perspective: Understanding OB principles helps individuals gain insights into their own behavior, motivations, and interactions within the workplace. It allows individuals to develop self-awareness, enhance their interpersonal skills, and navigate organizational dynamics effectively. This knowledge can benefit employees regardless of their position or role within the organization.

b. Team Perspective: OB provides valuable insights into team dynamics, collaboration, and conflict resolution. It helps individuals understand how to work effectively in teams, communicate, and leverage the strengths of team members. Regardless of one's position, teamwork and collaboration are often essential for achieving organizational goals.

c. Leadership Perspective: OB equips individuals with knowledge and skills to become effective leaders. Leadership is not limited to top-level management but can be practiced at all levels within an organization. Understanding OB principles can help individuals develop leadership competencies, influence others, and drive positive change within their sphere of influence.

d. Organizational Perspective: OB provides a holistic understanding of how organizations function, their structures, cultures, and systems. This knowledge is relevant for employees at all levels to comprehend the broader context within which they operate. It enables individuals to align their actions with organizational goals, adapt to changes, and contribute to the overall success of the organization.

To know more about organisational behaviour
Visit https://brainly.com/question/33529006
#SPJ11

how did you learn the way of interacting ang behaving with other members supported you to be socialized present your experience​

Answers

Answer:

Explanation:

It's still just one-to-one and getting to know. That's the only real way to learn the ways of interacting and behaving with another member of society.

There are three fundamental elements to socialization:

- Communications

- Courtesy

- Values.


· Bay of Pigs
· Fulgencio Batista
· Mariel Boat Lift
· economic boycott
All of these terms deal with U.S. involvement in what country's affairs?




Answers

Answer:

Cuba

Explanation:

Bay of Pigs: failed landing operation on the southwestern coast of Cuba in 1961 by Cuban exiles who opposed Fidel Castro's Cuban Revolution.

Fulgencio Batista:  Cuban military officer and politician who served as the elected President of Cuba, and as its U.S.-backed military dictator, before being overthrown during the Cuban Revolution.

Mariel Boat Lift: mass emigration of Cubans, who traveled from Cuba's Mariel Harbor to the United States.

Economic Boycott: the US currently imposes a commercial, economic, and financial embargo against Cuba.

why did the expansion of voting rights in the early 1800s benefit andrew jackson?

Answers

The voting rights in the early 1800s benefitted Andrew Jackson as the 1828 US presidential election was the 11th quadrennial one.

It was held from Friday, October 31 to Tuesday, December 2, 1828. It featured a repetition of the 1824 election, as President John Quincy Adams of the National Republican Party faced Andrew Jackson of the Democratic Party.

Both parties were new organizations, and this was the first presidential election their nominees contested. This election saw the second rematch in presidential history, something that would not occur again until 1840.

At the heart of the new legitimacy of parties and their forthright celebration of democracy was the dramatic expansion of VOTING RIGHTS for white men.

Learn more about Andrew Jackson at

https://brainly.com/question/15647756

Joh is inactive and negative in mood. He shows mild, low-key reactions to environmental stimuli. In Thomas and Chess's model of temperament, Joh would be classified as a(n) ________ child.

Answers

In Thomas and Chess's model of temperament, Joh would be classified as a slow-to-warm-up child.

Who are Slow-to-warm-up people?

These are the class of people who feel very uneasy and cautious when around a new environment or people.

Joh being inactive and negative in mood as a result of low-key reactions to environmental stimuli depicts a slow-to-warm-up child.

Read more about Temperament here https://brainly.com/question/6683393

Pontius Pilate was the Roman governor of Judea during the time Jesus lived. According to Christian scriptures, what role did Pilate have in Jesus' life?
A.
Pilate helped make peace between Jesus and the Jews.
B.
Pilate convinced the Roman emperor that Jesus was no threat.
C.
Pilate allowed Jesus to be executed by Roman soldiers.
D.
Pilate heard Jesus and was the first Roman to become Christian.

Answers

Answer: C.

Pilate allowed Jesus to be executed by Roman soldiers

Explanation:

After failing to convince the Jews to let Jesus go instead of a murderer. He allowed the Roman soldiers to crucify Jesus so as to pacify the Jews. He washed his hands off of the actions though so who knows where his soul is headed.

Brainliest?

Why thank you.


Explain an ethical dilemma faced by you and how you came
out of it. Put it on a PPT and share in the class.

Answers

An ethical dilemma is a situation where you are faced with a moral conflict, having to choose between two or more options, each of which has its own ethical implications.

Explaining an ethical dilemma you have encountered and how you resolved it can be done by sharing the context, outlining the conflicting values or principles involved, discussing the options considered, and describing the decision-making process that led to the resolution.

To explain an ethical dilemma you faced, start by providing background information about the situation, including the key stakeholders and the ethical issues at hand. Clearly articulate the conflicting values, principles, or obligations that made the decision challenging. Then, discuss the various options you considered and the potential consequences of each choice. Analyze the ethical implications of each option and explain the ethical frameworks or principles you used to guide your decision-making process.

Next, describe the steps you took to resolve the dilemma, including any consultations or discussions with others who may have been involved or affected. Emphasize how you weighed the ethical considerations and values involved, taking into account the potential impact on stakeholders and the broader implications of your decision. Finally, reflect on the outcome of your resolution, including any lessons learned or insights gained from the experience.

Remember to present your ethical dilemma and resolution in a clear, concise, and organized manner, highlighting the ethical reasoning and decision-making process you employed. Use examples, if possible, to illustrate the ethical dimensions of the situation.

Learn more about the dilemma here:

brainly.com/question/28221102

#SPJ11

Other Questions
calculate the production efficiency if an organism ingests 500 j from its food, uses 150 j in cellular respiration, allocates 100 j to growth and the rest is lost as feces. Evaluate the function below for x = 2.F(x) = 2x3 - x2 - 5x + 6 i must need 3rd question answer please.Delayla Bouquet France, the French subsidiary of a British company, Delayla Bouquet British has just received 4.4 million of additional investment from its British parent. Part of the investment is Adam has 10 sides in a bag five cherry sweets for lemon sweets in one on orange street. adam she's a sweet at random from the bag and eats it. he then takes another suite at random from the bag and it's up. adam says that the probability that itunes to spell cherry sweets is 25/100 he is incorrect explain his error Given the DNA sequence and three restriction enzymes (Hindill, Pstl and BamHI), write out the sequence of the digestion products for both DNA strands when the DNA sequence is subjected to digestion by a mixture of three restriction enzymes? 5 CTGTTACTGCAGCTAACGTGGATCCGGTCAATCTTCA 3 Restriction recognition sequences (1 - the cleavage site): Hindiri 5-A|AGCTT-3 3-TTCGA|A-5 BamHI 5-G|GATCC-3 3-CCTAG|G-5 Pst! 5-CTGCA G-3' 3-G|ACGTC-5 What is the significance of only one person of color in Night of the livingdead? Question 53 Look at the performance review below, if you know that person 6 has a perfect score, you can calculate each person's score using the graph. If you know that person 3 hasn't achieved any of their goals this year, Person 5 has an excellent personality and very good job knowledge, and Person 4 is more interested in hanging out at the water cooler than in getting work done, then who must the performance review belong to? Total number of points per employee Peson P2 Pesen3Psen 4 PeronS Person Rating Scale Category Ratings General Quality of Work 4 Very Good Good Job Knowledge Fair Communication Skills Personality Management Ability Contribution to Group Poor 4. Achievement of Goals Person5 2. Person 4 3. Person 3 The "Little Gator" has experienced just as much success off the racetrack. He was recently presented with the Mullinax Ford Community Hero Award for his community service. When asked what he believes is an important quality to succeed in life, Noah replied, "Helping people out." Despite his busy racing practice and competition schedule, Noah dedicates time to speak with students and make educational and inspirational films. In one film, Noah encourages other kids to dream big and work hard to achieve their dreams. In another film, he talks about the importance of respect. He reminds viewers, "Everyone is unique. We should be kind to everyone. Don't be a bully."Noah is a part of service projects to make a difference in his community. What explicit reason does he give in paragraph 4 for his participation in such activities? (5 points) a. He thinks it is important to help others. b. He likes to receive awards and recognition. c. He travels to different places and sees that people need help. d. He likes to make educational and inspirational films. Is 5 1/4 / 3 1/2 the same as 3 1/2 / 5 1/4? Explain. How would you engage front line taff in QI program when the day-to-day function alone can be o conuming? whats 2 plus 2 plus 3 plus 4 times 4 times six time pie in this assignment, you will write an express app that provides get endpoints to perform crud operations against mongodb. you will program the assignment using mongoose. how can an act of courage reveal a person's true nature? help please :( pls and tyyy retinal ganglion cell receptive fields can be thought of as detectors for please help asapwill give brainliest if 2 ppl answerWhich words should be stressed when the following poem is spoken aloud?Excerpt from The Fly by William BlakeLittle Fly,Thy summers playMy thoughtless handHas brushd away. Public domainthy and hasfly and handsummer and thoughtlesslittle and my which of the following strategies would most rapidly increase the genetic diversity of a population in an extinction vortex?question 5 options:a) establish a reserve that protects the population's habitat.b) sterilize the least fit individuals in the population.c) introduce new individuals from other populations of the same species.d) capture all remaining individuals in the population for captive breeding followed by reintroduction to the wild. Which of the following secondary sex characteristics do not develop in teen years The Pastoral Epistles were written to:a)Philemon and Titusb)Paul and Matthewc)Titus and Luked)Timothy and Johne)Timothy and TitusPLEASE! How do you think a cell performing cellular respiration rids itself of the resulting CO ?