Which triangle congruence postulate or theorem proves that these triangles are congruent?

Which Triangle Congruence Postulate Or Theorem Proves That These Triangles Are Congruent?

Answers

Answer 1

The triangle Congruence postulate/ theorem which proves that the triangles are congruent is; AAS congruence theorem.

Which triangle Congruence postulate proves that the given triangles are congruent?

As evident in the task content, it is required that the triangle Congruence postulate which proves the two triangles are congruent be determined.

By observation, the measures of <Y and <L are equal and the measures of <Z and <M are equal.

Also, the sides KM and XZ of both triangles are equal.

Hence, by the postulate of the AAS triangle congruency theorem which states that; When two angles and a non-included side of any two triangles are equal then they are said to be congruent.

Hence, the required congruence theorem is; AAS congruence theorem.

Read more on triangle congruence theorems;

https://brainly.com/question/14252518

#SPJ1


Related Questions

Ethan was busying marshmallows for a family bonfire. Each bag of marshmallows was 250 g. If Ethan wanted to buy 3 kg of marshmallows. How many bags would he need to buy?

Answers

it's 12 bags (3000/250)

Answer:12

Step-by-step explanation: There is 1000g in one kilogram, so it takes four bags of marshmallows to get 1 kilogram. This means that you need 2 more kilograms which takes 8 bags. Therefore 12 bags of marshmallows.

please help me i’m failing:/

please help me im failing:/

Answers

Answer:

Step-by-step explanation:

its c.

also dont give up hope

Answer:

C = 21

Step-by-step explanation:

trust me its correct brainliest pls

Circle p has a radius of 8 inches

Circle p has a radius of 8 inches

Answers

The area of the sector that is the smaller region of the circle is evaluated to be equal to 39.1 in² to the nearest tenth.

How to evaluate for the area of the sector.

The area of a sector is calculated by multiplying the fraction of the angle for the sector divided by 360° and πr², where r is the radius.

the angle of the sector = 70°

the radius = 8 ft

hence the area of the sector is calculated as follows:

(70°/360°) × 22/7 × 8 in × 8 in

we simplify by division and multiplication

1/36 × 22 × 64 in²

352 in²/9

39.1111 in²

Therefore, the area of the sector that is the smaller region of the circle is evaluated to be equal to 39.1 in² to the nearest tenth.

Know more about area of sector here: https://brainly.com/question/22972014

#SPJ1

Identify the pair of angles as complementary, supplementary, or neither HELP PLEASE!!

Identify the pair of angles as complementary, supplementary, or neither HELP PLEASE!!

Answers

Answer:

Complementary

Step-by-step explanation:

I'm guessing I'm not sure if this is 100% correct

I NEED HELP PLEASE!!!

I NEED HELP PLEASE!!!

Answers

Answer:

9-8=1 times 2 = 2

Step-by-step explanation:

let csc(x) = 14/10 where 0 < x < pi/2. Which ratio has a value of square root96/14?
A. cos(x)
B. sin(x)
C. sec(x)
D. cot(x)

Answers

Answer:

cot (x) ; D

Step-by-step explanation:

Mathematically;

cosec is 1/sin

So if cosec is 14/10 , then sin is 10/14

Sine refers to opposite/hypotenuse

So to get the adjacent, we use the pythagoras theorem.

According to this, the square of the hypotenuse equals the sum of the squares of the opposite and adjacent

Hence to get the value of the adjacent, we have;

14^2 - 10^2 = O^2

O^2 = 196-100

O^2 = 96

O = square root of 96

Now, mathematically, we know that Tan is opposite/ adjacent

So in this case tan = 10/√96

But cot is 1/tan

Thus cot = √96/10

So cot is our answer

Answer:

A. cos(x)

Step-by-step explanation:

late the sentence into an equation.
Three less than the product of 2 and a number is 4 .
Use the variable x for the unknown number.

Answers

The expression of the given statement is 2y - 3  = -1

What is Expression?

Expressions are mathematical statements that comprise either numbers, variables, or both and at least two terms associated by an operator. The operations of mathematics include multiplication, division, addition, and subtraction.

A phrase is considered a mathematical expression if it contains at least two numbers or variables and one or more mathematical operations. Let's look at how expressions are written.

The expression of the given statement is 2y - 3  = 4.

Here, let the unknown number = y

Now, product of y and 2 =  2 times  y   =   2y

Also, three less than the product   =  Product - 3

So, three less than the product  of 3 and y =  2 y - 3

Now, this above expression is equivalent to -1.

⇒2 y - 3  = -1

Hence the expression of the given statement is 2y - 3  = -1

To know more about Expression, visit:

https://brainly.com/question/1859113

#SPJ1

The sentence "Three less than the product of 2 and a number is 4" can be translated into the equation: 2x - 3 = 4

What is an equation?

A mathematical statement that demonstrates the equivalence of two expressions is known as an equation.

It has two sides that are divided by the equals sign (=).

Variables, constants, coefficients, operators, and functions can all be used in the expressions on either side of the equation.

Here, x represents the unknown number that we are trying to solve for. The expression "the product of 2 and a number" is represented by 2x, and "three less than" is represented by the subtraction of 3 from that product. This expression is set equal to 4, which is the result given in the original sentence.

To know more about expressions visit:

https://brainly.com/question/19131200

#SPJ1

Masha bought red, green, and yellow balloons for a party. She bought 40 red balloons. The number of green balloons Masha 3 bought is of the number of red balloons. The number of green 5
balloons is also 2 3 of the number of yellow balloons.
How many balloons did Masha buy for the party?

Answers

Answer:

its 100 ez bro

Step-by-step explanation:

Answer: 100 balloons

Step-by-step explanation:

because it is 100 balloons

x^2+12x−7=(x+p)^2−q. find the value of p and the value of q​

Answers

Answer:

p = 6 , q = 43

Step-by-step explanation:

x² + 12x - 7

using the method of completing the square

add/subtract ( half the coefficient of the x- term )² to x² + 12x

=x² + 2(6)x + 36 - 36 - 7

= (x + 6)² - 43 ← in the form (x + p)² - q

with p = 6 and q = 43

.
A jar contains 11 green marbles, 6 red marbles, and 9 blue marbles. A marble is selected at random, not replaced, and then a second marble is selected. What is the probability of selecting a red marble followed by a green marble?

Answers

Answer:

red marbel

\( = \frac{3}{13} \)

green marbel

\( = \frac{9}{26} \)

Step-by-step explanation:

for the red marbel you first add all the number of balls given and the total is 26 then you take the number of red marbels dividing the total number of all the balls and if you are able to cancel out you can and there you get your answer same applies to the green marbel

The key phrase here is “not replaced”
The probability of choosing red first is 6/26
There are only 25 marbles left!
The probability of now picking green is 11/25.
So P(Red then Green) = 6/26 x 11/25 = 66/650 = 33/325

PLEASE HELP ='D
THANK YOOOOOOOOOOOU

PLEASE HELP ='DTHANK YOOOOOOOOOOOU

Answers

The answer is C. u were correct

Answer:

yes you have it marked correctly in the image

Lorenzo and his sister, Mariana, are decorating gingerbread houses. They want to make grass, so they turn their icing green by mixing yellow and blue food coloring. Both of them use the same amount of yellow food coloring, but Mariana adds less blue food coloring than Lorenzo. Whose icing is a darker shade of green?​

Answers

Answer:

lorenzo

Step-by-step explanation:

because he has added more blue shade which will make the icing darker , Mariana's icing will be lighter as she added less blue shade :)

Answer:

Lorenzo's icing.

Step-by-step explanation:

They both used the same amount of yellow icing, but if Mariana adds less blue food coloring, then Lorenzo's icing will be darker because he added more blue than Mariana.

Danny says 4 < 6, so 204 < 216. Is his reasoning correct? Explain.

Danny says 4 &lt; 6, so 204 &lt; 216. Is his reasoning correct? Explain.

Answers

As given by the question

There are given that 4<6, so 204<216.

Now,

On the number line, 4 is less tha6 and 204 is also less than 216

Hence, the given reasoning is correct.

What is 50% of 36?
9
16
ООО
18
34

Answers

HELP FAST !!! PLEASE

Solve the system by substitution.
y = -5x + 40
y = 3x

Answers

Answer:

X=5 y=15

Step-by-step explanation:

you got to solve the first variable in the first equation, then substitute the result in to the other.

Solution for the system of equations y = -5x + 40 and y = 3x are:

x = 5 , y = 15 .

What is substitution method?

The substitution method is the algebraic method to solve simultaneous linear equations. As the word says, in this method, the value of one variable from one equation is substituted in the other equation.

Given equations

y = -5x + 40   ------(a)

y = 3x           -------(b)

Substituting value of y from equation (b) to equation(a)

3x = -5x + 40

⇒ 3x + 5x = 40

⇒ 8x = 40

⇒ x = 40/8

⇒ x = 5

Substituting value of x in equation (b)

y = 3 × 5

⇒ y = 15

Hence, x = 5 and y = 15 are the solutions

for the system of equations

y = -5x + 40 and y = 3x

Learn more about substitution method here:

brainly.com/question/14619835

#SPJ2

If 15% of the customers total is $98,880, then the sum total equals what

Answers

The sum total by the given data is equals to $658,880.

We are given that;

Percent=15%

Amount= $98,880

Suppose the value of which a thing is expressed in percentage is "a'

Suppose the percent that considered thing is of "a" is b%

Then since percent shows per 100 (since cent means 100), thus we will first divide the whole part in 100 parts and then we multiply it with b so that we collect b items per 100 items(that is exactly what b per cent means).

To divide by a percentage, we can convert it to a decimal by moving the decimal point two places to the left. This gives us:

15% = 0.15

To divide by 0.15, we can multiply by its reciprocal, which is 1/0.15. This gives us:

$98,880 / 0.15 = $98,880 x 1/0.15

To multiply by 100, we can move the decimal point two places to the right. This gives us:

$98,880 x 1/0.15 x 100 = $658,880

Therefore, by the percentage the answer will be $658,880.

Learn more about percent here:

https://brainly.com/question/11549320

#SPJ1

HELP ME PLEASEEEEEEEEEEEEEEEEEEEEEEEEEEEE WILL GIVE BRAINLIST

HELP ME PLEASEEEEEEEEEEEEEEEEEEEEEEEEEEEE WILL GIVE BRAINLIST
HELP ME PLEASEEEEEEEEEEEEEEEEEEEEEEEEEEEE WILL GIVE BRAINLIST

Answers

Answer:

\(24m^{3}\)

Step-by-step explanation:

V = \(a^{2} \frac{h}{3}\)

a = 3

h = 8

If we put this on out formula, it would look:

V = \(3^{2} \frac{8}{3}\)

V = 9\(\frac{8}{3}\)

\(\frac{8}{3}\) = 2.67

V = 9 x 2.67

V = 24.03

Round to the nearest whole number:

24.03 = 24

Answer:

A) 24 m 3

Step-by-step explanation:

3 Jack walk from Santa Clara to Polo Allo. Il took I hour 25 min to walk from Santa Clot to Los Altos. Than it took 25 minute of wal from los altos to Palo buto. He arrived in Palo alto at 2:45 P.M. of what time die Santa Clara ? he leave Santa clara​

Answers

The time Jack left Santa Clara is 1 : 55 pm

What is word problem?

A word problem in math is a math question written as one sentence or more. These statements are interpreted into mathematical equation or expression.

The time for Jack to walk to lose Altos is 25 min and he uses another 25mins to work to Palo alto.

Therefore, the total time he spent is

25mins + 25 mins = 50 mins

He arrived Palo at 2 :45 pm, therefore the time he left Santa Clare will be ;

2:45 pm = 14 :45

= 14:45 - 50mins

= 13:55

= 1 : 55pm

Therefore he left at 1:55 pm

learn more about word problem from

https://brainly.com/question/21405634

#SPJ1

2x-1=y
3x-1=y

Consider the system of equations above. Which of the following statements about this system is true?

2x-1=y 3x-1=yConsider the system of equations above. Which of the following statements about this system

Answers

Answer:

B; There is only one (x,y) solution and y is negative

Step-by-step explanation:

First, I graphed the two equations. Attached is an image of the equations graphed. Next, I looked for overlapping points. Wherever the two points overlap, there is a solution. When looking at the graph, we can see the lines overlap at only one point, (0,-1). Since y is negative, the answer must be B; there is only one (x,y) solution and y is negative.

If this answer helped you, please leave a thanks!

Have a GREAT day!!!

2x-1=y 3x-1=yConsider the system of equations above. Which of the following statements about this system

What is the distance between the following points?
Please help me ASAP
( I will mark BRAINLIEST )

What is the distance between the following points?Please help me ASAP( I will mark BRAINLIEST )

Answers

the answer is square root of 21

Answer:

\(\sf \boxed{\sf distance: \ 5 \ units}\)

Explanation:

The points represented (marked blue) are (8, 5), (4, 2)

\(\sf Distance\ between \ two \ points : \sqrt{(x_2 -x_1)^2+(y_2 - y_1)^2 }\)

Insert values:

\(\rigtharrow \sf \sqrt{(8-4)^2 + (5-2)^2}\)

\(\rightarrow \rigtharrow \sf \sqrt{16 + 9}\)

\(\rightarrow \rigtharrow \sf 5\)

K
A department store paid $49.38 for a salad bowl Overhead expense is 17% of the regular selling price and profit is 11% of the regular selling price. During a clearance sale, the set was sold at a markdown of
44% What was the operating profit or loss on the sale?
The operating
(Round the final answer to the nearest cent as needed. Round all intermediate values to six decimal places as needed.)

Answers

Operating Loss on the sale of the salad bowl is $19.75.

What are profit and loss?

Profit is gained amount after selling any item when selling price is more than the cost.

Loss is the lost amount after selling any item, when selling price is less than the cost.

Given,

Cost of the salad bowl = $49.38

Overhead expense = 17%

Overhead expense

= 17 × 49.38/100

= $8.3936

Total cost

= $49.38 + $8.3936

= 57.7736

Profit = 11%

Profit

= 11 × 49.38/100

= 5.4318

Cost = 57.7736 - 5.4318

Cost = 52.3418

On sale markdown on price = 44%

then selling price = 66%

selling price

= 66×49.38/100

= 3259.08/100

= $32.5908

Loss

= Cost - selling price

= 52.3418 - 32.5908

= 19.751

= $19.75

Hence, there is loss of $19.75 on the sale of salad bowl.

Learn more about profit and loss here:

https://brainly.com/question/13934673

#SPJ9

Consider the function below, which has a relative minimum located at (-3, -18) and a relative maximum located at 1/3, 14/27). f(x) = -x3 - 4x2 + 3x. Select all ordered pairs in the table which are located where the graph of f(x) is decreasing: Ordered pairs: (-1, -6), (2, -18), (0, 0),(1 , -2), (-3 , -18), (-4. , -12)

Answers

The ordered pairs (-1, -6), (2, -18), (0, 0), and (-4, -12) do not correspond to the intervals where the graph of f(x) is decreasing. The pairs (1, -2) and (-3, -18) are the correct ones.

To determine where the graph of f(x) is decreasing, we need to examine the intervals where the function's derivative is negative. The derivative of f(x) is given by f'(x) = -3x^2 - 8x + 3.

Now, let's evaluate f'(x) for each of the given x-values:

f'(-1) = -3(-1)^2 - 8(-1) + 3 = -3 + 8 + 3 = 8

f'(2) = -3(2)^2 - 8(2) + 3 = -12 - 16 + 3 = -25

f'(0) = -3(0)^2 - 8(0) + 3 = 3

f'(1) = -3(1)^2 - 8(1) + 3 = -3 - 8 + 3 = -8

f'(-3) = -3(-3)^2 - 8(-3) + 3 = -27 + 24 + 3 = 0

f'(-4) = -3(-4)^2 - 8(-4) + 3 = -48 + 32 + 3 = -13

From the values above, we can determine the intervals where f(x) is decreasing:

f(x) is decreasing for x in the interval (-∞, -3).

f(x) is decreasing for x in the interval (1, 2).

Now let's check the ordered pairs in the table:

(-1, -6): Not in a decreasing interval.

(2, -18): Not in a decreasing interval.

(0, 0): Not in a decreasing interval.

(1, -2): In a decreasing interval.

(-3, -18): In a decreasing interval.

(-4, -12): Not in a decreasing interval.

Therefore, the ordered pairs (-1, -6), (2, -18), (0, 0), and (-4, -12) are not located in the intervals where the graph of f(x) is decreasing. The correct answer is: (1, -2), (-3, -18).

For more question on  intervals visit:

https://brainly.com/question/30460486

#SPJ8

Note the complete and the correct question is

Q- Consider the function below, which has a relative minimum located at (-3, -18) and a relative maximum located at 1/3, 14/27).

\(f(x) = -x^3 - 4x^2 + 3x\).

Select all ordered pairs in the table which are located where the graph of f(x) is decreasing: Ordered pairs: (-1, -6), (2, -18), (0, 0),(1 , -2), (-3 , -18), (-4. , -12)

a/b - c + d if a = 7/8, b= -7/16, c= 0.8 and d= 1/4 write your answer as a mixed number in simplest form? help me please

Answers

To solve this expression, we need to substitute the given values of a, b, c, and d into the expression and simplify:

a/b - c + d = (7/8) / (-7/16) - 0.8 + 1/4

We can simplify the first term by dividing the numerator by the denominator and multiplying by the reciprocal:

(7/8) / (-7/16) = (7/8) * (-16/7) = -2

Substituting this value, along with the values of c and d, we get:

a/b - c + d = -2 - 0.8 + 1/4

Combining the constant terms, we get:

a/b - c + d = -2.8 + 1/4

To express this as a mixed number in simplest form, we first convert the decimal to a fraction by multiplying both the numerator and denominator by 100:

-2.8 + 1/4 = -280/100 + 25/100

Combining these fractions, we get:

-280/100 + 25/100 = -255/100

To express this as a mixed number, we divide the numerator by the denominator to get the whole number part, and express the remainder as a fraction of the denominator:

-255/100 = -2 55/100 = -2 11/20

Therefore, the answer in mixed number form is -2 11/20.

you want wall-to-wall carpeting in your room, which measures 24' x 1' . Carpeting is on sale for 9.97 per square yard. estimate the cost. round answer where possible.

Answers

Answer:

Step-by-step explanation:

First, we need to convert the dimensions of the room from feet to yards, since the price is given per square yard.

24 feet = 8 yards (since 1 yard = 3 feet)

So the dimensions of the room are 8 yards x 1 yard.

The area of the room is 8 x 1 = 8 square yards.

The cost of the carpeting per square yard is $9.97.

So, the estimated cost of the carpeting would be:

8 x $9.97 = $79.76

Rounding this to the nearest cent gives an estimated cost of $79.76.

The integrated curriculm mode, sometimes referred to as integrative teaching, is both a method of teaching and a way of organising the teaching programme so that many subject areas and skills provided in the curriculum can be linked to one another. Provide an example of how you, as the teacher, could use the content in Social Sciences as a vehicle for mathematical skills development.​

Answers

The teacher can thus use social sciences as a vehicle to develop mathematical skills by facilitating the development of skills such as data interpretation and analysis.

As an instructor, I would use social sciences to develop mathematical skills in the following manner:Consider a social science topic like demography. In this case, a teacher could use mathematics to assist students in interpreting population statistics.

Teachers might guide students to gather information about population size, growth rate, and geographical distribution from various countries and then use statistics to analyze the data.

For example, a teacher could give students graphs or charts to help them understand population growth rates. They can be asked to make comparisons and identify trends.

In this way, students' understanding of the population is improved, as is their mathematical reasoning.Aside from using mathematics to interpret population statistics,

the teacher can also incorporate mathematical skills development in social sciences by using methods that involve understanding and analysis of data. In other words, students learn how to use data to reach conclusions and make decisions.

They learn how to interpret data and how to extract information from it.This method of teaching creates opportunities for the use of the same skills in different contexts and areas of learning.

It enables students to see connections between subjects and fosters an integrated approach to learning.

To learn more about : development

https://brainly.com/question/28324913

#SPJ8

Question 6.
Find the volume.

Question 6.Find the volume.

Answers

Answer:

128π ft³ ; 401.92 ft³

Step-by-step explanation:

The volume of the cylinder Given above :

Volume of cylinder, V = πr²h

r =Radius = 4 ; h = 8 ft

V = π * 4² * 8

V = 16 * 8 * π

V = 128π ft³

Using π = 3.14

V = 128 * 3.14 = 401.92 ft³

what percent of 75 is 57?

Answers

Answer:

76%

Step-by-step explanation:

57/75

(57 X 100)/ 75

5700/75

1900/25

76/1

76

Let U= {x | x is a whole number and 0 ≤ x ≤ 19) and C= {15, 16, 17, 18, 19). Write U U C using the listing method.
UUC=

Answers

set, in mathematics and logic, any collection of objects (elements), which may be mathematical (e.g., numbers and functions) or not. A set is commonly represented as a list of all its members enclosed in braces. The intuitive idea of a set is probably even older than that of number.

Let C=15, 16, 17, 18, and 19) and U=x | x is a full number and 0 x 19). Use the listing technique to write U U C.

UUC=

D U E = { 16, 18, 19, 20, 21 }

U stands for the union of sets.

We combine all of the components from the two groups.

16, 19, 21, and 16, 18, 19, 20 are the elements in sets D and E, respectively.

Therefore, we combine all of their components. The shared components of both sets are written just once.

As a result, there are 16, 18, 19, 20, and 21 elements in the set D U E.

To learn more about set Visit : https://brainly.com/question/13651950

#SPJ9

Identify all English-language sentences below that are a strict translation of the formal statement that will follow. To be a strict translation, the English-language sentence must not drop any information that is explicit in the formal statement, nor can it add any information not explicit in the formal statement. [At least one of the statements will be a strict translation.] Formal Statement: Vn e Z+, Im E Z, m < n | m + n = 0 Note: Given an integer n, if there exists an integer m such that m + n = 0, then m is called the additive inverse of n. Every non-zero integer has a non-zero additive inverse. Every integer has an additive inverse. For every positive integer, there exists a unique lesser integer that when added to the positive integer results in an answer of zero. For every positive integer, there exists at least one lesser integer such that the lesser integer is the additive inverse of the positive integer.

Answers

The additive inverse of an integer n can be expressed mathematically as Vn e Z+, Im E Z, m < n | m + n = 0, which states that if an integer m exists such that m + n = 0, then m is the additive inverse of n.

The formal statement can be expressed mathematically as:

Vn e Z+, Im E Z, m < n | m + n = 0

This statement translates to: Given an integer n, if there exists an integer m such that m + n = 0, then m is the additive inverse of n.

To understand this statement more clearly, we can use an example. Let's say n = 5. This means that we are looking for an integer m such that m + 5 = 0. In this case, m = -5, which is the additive inverse of 5. We can also calculate this mathematically. We know that m + n = 0, so we can rearrange and solve for m: m = -n. Therefore, the additive inverse of n is -n.

In summary, given an integer n, the additive inverse of n is -n. This can be expressed mathematically using the statement Vn e Z+, Im E Z, m < n | m + n = 0.

The additive inverse of an integer n can be expressed mathematically as Vn e Z+, Im E Z, m < n | m + n = 0, which states that if an integer m exists such that m + n = 0, then m is the additive inverse of n.

Learn more about additive inverse here:

https://brainly.com/question/13715269

#SPJ4

Hector tosses a coin 80 times and gets 46 heads and 34 tails. What is the relative frequency of tails? 0 34% O 42.5% O 50% O 57.5%

Hector tosses a coin 80 times and gets 46 heads and 34 tails. What is the relative frequency of tails?

Answers

Explanation:

The relative frequency of an outcome is the number of times you get this outcome divided by the number of times the experiment was repeated:

\(\frac{\#\text{tails}}{\#\text{times Hector tosses the coin}}=\frac{34}{80}=0.425\)

To find it as a percentage we just have to multiply by 100:

\(0.425\times100=42.5\text{ \%}\)

Answer:

42.5%

Other Questions
Explain how microscopic and macroscopic anchoring of muscle filaments enables you to bend your elbow. What was a factor in Woodrow Wilson's 1912 election victory? Responses Roosevelt withdrew and endorsed Wilson. Roosevelt withdrew and endorsed Wilson. Taft had decided not to run and endorsed Wilson. Taft had decided not to run and endorsed Wilson. Wilson was more progressive than either Taft or Roosevelt. Wilson was more progressive than either Taft or Roosevelt. Roosevelt and Taft split the Republican votes. A nurse is preparing to administer dextrose 5% in water (D5W) to infuse at 125 mL/hr. The drop factor of the manual IV tubing is 15 gtt/mL. The nurse should set the manual IV infusion to deliver how many gtt/min? If flowering were inhibited in both parts of the grafted plants, what would you conclude? explain economic according to Adam smith can you please compare the DNA sequences in thisimage, mark any insertion, deletion, polymorphism, and addition.Discuss about the yellow region in sequences and the nucleotides.discuss all the simi>M12-LCMT-F_D02.ab1TAAAGCCATTTACCGTACATAGCAC >M13-LCMT-F E02.ab1TAAAGCCATTTACCGTACATAGCAC >M14-LCMT-F_F02.ab1TAAAGCCATTTACCGTACATAGCAC325 >M15-LCMT-F_G02.ab1TAAAGCCATTTACCGTACATAGCAC >M16-LCMT-F_H02.ab1TAAAGCCATTTACCGTACATAGCAC>M12-LCMT-F_D02.ab1ATTACAGTCAAATCCCTTCTCGTCC>M13-LCMT-F_E02.ab1ATTACAGTCAAATCCCTTCTCGTCC >M14-LCMT-F F02.ab1ATTACAGTCAAATCCCTTCTCGTCC350>M15-LCMT-F G02.ab1ATTACAGTCAAATCCCTTCTCGTCC>M16-LCMT-F_H02.ab1ATTACAGTCAAATCCCTTCTCGTCC w >M12-LCMT-F_D02.ab1CCATGGATGACCCCCCTCAGATAGG>M13-LCMT-F_E02.ab1CCATGGATGACCCCCCTCAGATAGG >M14-LCMT-F_F02.ab1CCATGGATGACCCCCCTCAGATAGG375 >M15-LCMT-F_G02.ab1CCATGGATGACCCCCCTCAGATAGG>M16-LCMT-F_H02.ab1CCATGGATGACCCCCCTCAGATAGG>M12-LCMT-F_D02.ab1GGTCCCTTGACCAC>M13-LCMT-F_E02.ab1GGTCCCTTGACCAC >M14-LCMT-F_F02.ab1AGTCCCTTGACCAC >M15-LCMT-F_G02.ab1GGTCCCTTGACCAC>M16-LCMT-F H02.ab1GGTCCCTTGACCAC 400 How to solve 5y + 34 = -2 (-7y+1) Gary Foshee created a popular probability puzzle that goes like this: "I have two children. One is a boy born on a Tuesday. What is the probability I have two boys?"In this puzzle, knowing that one of Gary's children was born on a Tuesday is as important as knowing that he has one boy. Assuming that having boys and girls are equally likely and that births are equally likely on every day of the week, what is theprobability that Gary has two boys, given the available information? (Hint: When Gary said that one is a boy born on aTuesday, he meant at least one child is a boy born on a Tuesday. )a Please help me ASAPWILL MARK BRAINLY 3. When using the vertical method to multiply polynomials, your like terms must be lined up in what rowscolumnsdescending orderascending order Describe how climate would be influenced if: Earths distance from the sun was to change. Earths tilt changed. Describe how climate would be influenced if: An asteroid or comet would impact earth. Solar activity decreased and increased. What is it called when a society is male dominated? Which of the following is true of cellular respiration but not of photosynthesis? Cellular respiration releases energy from glucose. Cellular respiration releases oxygen gas as a product. Cellular respiration is a process in which glucose is formed. Cellular respiration requires carbon dioxide and water as reactants. Which statement appropriately identifies a risk nursing diagnosis for a client who is confined to bed What is pressure group example? Write an equation of the line that passes through the given point and has the given slope.(6, 4); slope- 3/4 draw the structure for 2-methyl-3-propalhex-2-yne What is the sequence and the common difference/ ratio for number 12 Which filter does this image illustrate? A. blur filter B. texture filter C. render filter D artistic filter Consider a small open economy. The saving curve is given by s dcrw) = 100 + 2000r w The investment curve is given by 10 (TW) = 300 1000r w. Let the interest rate by 5%. Then the economy's current account balance is a. -50 b.50 C. -200 d. 200 FILL THE BLANK. The minimum flight visibility for VFR flight increases to 5 statute miles beginning at an altitude of _____