Which of these is NOT a testable hypothesis?
O Plants that receive compost will taste better
O Plants that receive more light will grow at a faster rate
O Adding fertilizer to plants will cause them to grow at a faster rate
O Plants that receive less water will grow at a slower rate

Answers

Answer 1

Answer:

Plants that receive compost will taste better

Explanation:

Answer 2

Answer:

A

Explanation:

Plants that receive compost will taste better is wrong because there is no accusation for what will happen, they are just saying a statement that it tastes better.


Related Questions

1. The following gene sequence appears on one strand of a segment of DNA that is about to go
through DNA Replication. What code will DNA Polymerase build to make the complementary
strand?
TACGGCATATGCAAATGGCGAGCCTATATT

Answers

The DNA polymerase will build the complementary strand with the code: ATGCCGTATACGTTTACCGCTCGGATATA.

What is DNA replication?

DNA replication is a process by which a DNA molecule makes a copy of itself. During DNA replication, an enzyme called DNA polymerase reads the existing DNA strand and builds a new complementary strand by matching up the appropriate nucleotides.

To build the complementary strand of DNA, we need to use the base pairing rules: adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G).

So, for each base in the original sequence, we will pair it with its complement:

Original strand: TACGGCATATGCAAATGGCGAGCCTATATTComplementary strand: ATGCCGTATACGTTTACCGCTCGGATATA

Learn more about DNA Replication here: https://brainly.com/question/21265857

#SPJ1

The complementary strand to the given sequence would be:

ATGCCGTATACGTTTACCGCTCGGATATAA

What is gene sequence?

A gene sequence is a specific sequence of nucleotides in DNA (or RNA) that encodes the genetic information for a particular trait, function or protein. Genes are the basic unit of heredity and are responsible for passing on traits from one generation to the next.

The complementary strand of DNA will have a sequence that pairs each nucleotide with its complementary base: adenine (A) with thymine (T), and cytosine (C) with guanine (G). Therefore, the complementary strand to the given sequence would be:

ATGCCGTATACGTTTACCGCTCGGATATAA

During DNA replication, DNA polymerase reads the existing strand from 3' to 5' and builds the complementary strand in the 5' to 3' direction. Therefore, the new strand would be synthesized by adding nucleotides in the following order:

ATA...CGT...TAA...CGC...TGG...ATA

Learn about complementary strand here https://brainly.com/question/1534778

#SPJ1

While standing near a river, a student noticed small rocks colliding with larger rocks, causing small pieces to break off and be carried
downstream. What processes is the student observing?
A. The small rocks are chemically weathering the larger rocks and erosion is moving the pieces downstream.
B. The small rocks are chemically weathering the larger rocks and deposition is moving the pieces downstream.
C The small rocks are mechanically weathering the larger rocks and erosion is moving the pieces downstream.
D. The small rocks are mechanically weathering the larger rocks and deposition is moving the pieces downstream.

Answers

C. The small rocks are mechanically weathering the larger rocks and erosion is morning the pieces downstream

There is no chemical change in this so it has to be mechanically. Than erosion is causing the rocks to be moving the pieces downstream. Deposition means another thing...

PLEASE HELP ME WITH THIS QUESTION

PLEASE HELP ME WITH THIS QUESTION

Answers

Answer:

oxygen

Explanation:

in photosynthesis the plants that uses carbon dioxide and light energy to produce glucose and release oxygen

the answer is b carbon dioxide

What two characteristics must a question have to be a valid scientific question?A. Random and uncertain B. Immortal and unwholesome C. Unpopular and unbelievable D. Observable and testable

Answers

Okay, Max123d, so we could make a valid scientific question if we consider a few important facts, like the studied context, and the information regarding those subjects. So we could make it having an observable and testable hypothesis.

The answer to this question is:

D. Observable and testable

What is the structure of a nucleotide? What are DNA's four nucleotides, and how do they pair up?

Answers

Answer:

Attached to each sugar is one of four bases--adenine (A), cytosine (C), guanine (G), or thymine (T). The two strands are held together by hydrogen bonds between the bases, with adenine forming a base pair with thymine, and cytosine forming a base pair with guanine.

A base pair is two chemical bases bonded to one another forming a "rung of the DNA ladder." The DNA molecule consists of two strands that wind around each other like a twisted ladder. Each strand has a backbone made of alternating sugar (deoxyribose) and phosphate groups. Attached to each sugar is one of four bases--adenine (A), cytosine (C), guanine (G), or thymine (T). The two strands are held together by hydrogen bonds between the bases, with adenine forming a base pair with thymine, and cytosine forming a base pair with guanine.




Some cofactors participating in reactions of the citric acid cycle are given. Identify the position or positions each cofactor has in the cycle by selecting the appropriate letter or letters designating that position in the cycle diagram.
NADH+H+
FADH2--> H
GTPNADH+H+--> BDJ
FADH2--> H
GTP--> F

Answers

The cofactor and the appropriate letter or letters showing the position in the cycle diagram are:

NADH+H+ - BDJ

FADH2- H

GTP - F

A cofactor is known to be a kind of  chemical  compound that is said to be non-proteinous in nature. It is also known to be a metallic ion that is often needed in any reaction as a kind of catalyst in that chemical reaction.

Note that the Cofactors is often seen as the "helper molecules" that boast  biochemical transformations and as such the letters that show the  position in the cycle diagram are the ones given above.

Learn more about cofactor from

brainly.com/question/13452695

#SPJ4

Pleaseeeeeeeee helpppp meeeeee

Pleaseeeeeeeee helpppp meeeeee

Answers

Answer:

D.

Explanation:

For two organisms to breed successfully and produce viable offspring that are fertile, both must belong to the same species with the same number of chromosomes.

Postzygotic barrier often occur when two organisms of different species and chromosomes numbers mate. If successful, the hybrid they produce remain sterile. This is what happens when goat with chromosome number of 60, mates with sheep with chromosome number of 54.

Postzygotic barrier is responsible for the sterility of the hybrid they produce, as a result of difference in chromosome number between sheep and goat.

another word for prokaryote is what

Answers

Another word for prokaryote is : being, procaryote.

Another name for prokaryote is: Archaea and Bacteria .

why do children need more protein
in there diet​

Answers

They help repair and maintain vital tissues and, are crucial for the growth of all organs systems including bones and muscles. Proteins in the body also work as enzymes, immune molecules, hormones and cellular messengers. Therefore, proteins are vital for the growth and development of every child

you have isolated an aerobic gram-positive, endospore-forming bacterium that grows well on nutrient agar. to which of the following groups does it most likely belong?

Answers

isolated an aerobic gram-positive, endospore-forming bacterium that grows well on nutrient agar is belong to the group Bacillales.

Bacillus, which means "stick" in Latin, is a phylum of Gram-positive, rod-shaped bacteria and contains 266 identified species. The term is also used to refer to the shape (rod) of other similarly shaped bacteria; the phrase is also used to refer to the class of bacteria to which this genus belongs, which is known by the plural Bacilli. Obligate aerobes, which require oxygen to survive, and facultative anaerobes, which may live without it, are two different types of Bacillus species. If oxygen has been utilised or is present, cultured Bacillus species test positive for the enzyme catalase.

Bacillus can transform into oval endospores and can survive for years in this inactive state. One species from Morocco is said to have had its endospore survive being heated to 420 °C. [2] When nutrients are scarce, endospore development often occurs as a result of bacterial division within the cell wall followed by engulfment of one side by the other. They aren't actually spores (i.e., not an offspring).  The genus was initially classified by endospore production, but not all of these species are linked to one another, and many species have been transferred to other genera of the Bacillota.  Each cell only produces one endospore. Heat, cold, radiation, desiccation, and disinfectants cannot harm the spores.

For more such questions on Bacillus , Refer:

https://brainly.com/question/29670729

#SPJ4

There are three sources of genetic variation in sexual reproduction. Determine which of the following statements accurately describes which of these are considered random and which are not

Answers

Genetic recombination and independent assortment are considered random sources of genetic variation, while mutations can occur randomly or due to specific factors.

In sexual reproduction, the three sources of genetic variation are genetic recombination, independent assortment, and random mutations. Among these sources, genetic recombination and independent assortment are considered random processes, while mutations are not entirely random.Genetic recombination occurs during meiosis when homologous chromosomes exchange genetic material through crossing over. This process is considered random as the precise locations where recombination events occur are unpredictable.Independent assortment refers to the random alignment and separation of homologous chromosomes during meiosis I. The random positioning of maternal and paternal chromosomes contributes to genetic diversity in offspring.On the other hand, mutations are not entirely random as they can be influenced by various factors such as exposure to mutagens or errors in DNA replication. However, the specific mutations that occur at particular loci are generally considered random events.Therefore, the accurate statement would be that genetic recombination and independent assortment are considered random sources of genetic variation, while mutations are influenced by both random and non-random factors.

For more such questions on Genetic variation:

https://brainly.com/question/23840938

#SPJ8

Which process occurs in the ostrich embryo's body (somatic) cells as it grows larger within its egg?

Answers

Answer:

Mitosis creates copies of cell nuclei.

Explanation:

I did the test

Which process occurs in the ostrich embryo's body (somatic) cells as it grows larger within its egg?

9
B There are two missing words in each question Put them in
Example:
8
your parents got jobs and, if so, what they do?
Have your parents got jobs, and if so, what do they do?
When trains for London leave and how much a return ticket?
6
7
Where you buy your new mobile phone and how much it cost?
Where you last night and what you do?
Where I buy a cheap computer in this town and how I get there?

Answers

Answer:

that's all I can.

hope it helps. good day.

9B There are two missing words in each question Put them inExample:8your parents got jobs and, if so,

Both metals and nonmetals are __________.
conductors
elements
solids

Answers

Answer:

Elements is the correct one

Explanation:

are blood cells nucleated ?

Answers

Explanation:

all of these red blood cells are nucleated.

Red blood cells are nucleated.

Some DNA-DNA hybridization data place the giant panda in the bear family (Ursidae), but place the lesser panda in the raccoon family (Procyonidae). The similarity of body morphology of these two animals must therefore be due toa.inheritance of acquired characteristics.b.sexual selection.c.inheritance of shared derived characters.d.convergent evolution.e.possession of shared primitive characters.

Answers

Answer:

d. convergent evolution

Explanation:

Convergent evolution refers to the independent evolution of similar phenotypic/morphological traits in organisms that are not closely related (i.e., they are not monophyletic). Convergent evolution leads to the development of analogous structures, i.e., similar structures that have the same/similar purposes but were not present in the last common ancestor of these groups. A well-known example of convergent evolution is the wings of the butterfly and bat. Conversely, divergent evolution is a type of pattern of evolution that leads to the accumulation of phenotypic differences between closely related species/populations/individuals.

what is the analogy between the vacuole and a school?

Answers

Answer:

The vacuoles is like the cabinets in the school used to store items. where we release all of our energy. Cytoplasm is like the hallways of the school.

1. What is the phenotype for the color of this pea plant seed?
yy
green
Yy
yellow
YY

1. What is the phenotype for the color of this pea plant seed?yy greenYy yellowYY

Answers

Answer: green

Explanation:
The phenotype is the set of observable physical traits while genotypes are the organism’s genetic information. Since the question is asking for the phenotype they are looking for the observable traits not the genetic makeup. :)

Pikas grow thick fur in winter, and their small bodies conserve heat. Kangaroo rats
do not sweat, and oily fur helps them conserve moisture. They get water from seeds.
Predict what would happen if a pika and a kangaroo rat switched environments.

Answers

If a pika and a kangaroo rat switched environments, they might not survive for long due to their unique adaptations to their particular environments.

A pika's adaptation to its habitat includes growing thick fur in winter to conserve heat. In contrast, the desert environment where the kangaroo rat lives is very hot and dry; therefore, its oily fur helps to conserve moisture rather than heat. The pika's thick fur would make it too hot in the desert environment, whereas the kangaroo rat's oily fur would not be sufficient to conserve moisture in the colder environment.

Additionally, pikas get their water from consuming snow whereas kangaroo rats get water from seeds. In a colder environment, snow is readily available, but in the desert, there is no snow. The kangaroo rats might not be able to survive in colder environments if they do not have access to water, and the pika might not be able to survive in the desert without access to snow.

Therefore, it is likely that the adaptations that allowed the pika and the kangaroo rat to survive in their respective environments would make it difficult for them to survive if they were to switch habitats.

Suppose rising sea levels again separate the continents of North and South America. Choose one of Earth's spheres, and explain how it might interact differently with another of Earth's spheres because of this change.

Answers

The separation of North and South America by rising sea levels would result in changes in the interaction between the biosphere and the hydrosphere. Disrupted migration patterns, altered nutrient distribution, and changes in habitat availability would affect the biodiversity and ecological dynamics in the marine ecosystem.

If rising sea levels were to separate the continents of North and South America, one sphere that would interact differently with another sphere is the biosphere and the hydrosphere.

The biosphere refers to all living organisms and their interactions with the environment, while the hydrosphere encompasses all water bodies on Earth, including oceans, lakes, rivers, and groundwater. The separation of North and South America by rising sea levels would result in significant changes in the distribution and connectivity of marine habitats, impacting the biodiversity and ecological dynamics in both spheres.

With the separation of the continents, marine species that depend on migratory patterns, such as marine mammals, fish, and sea turtles, may face challenges in their natural movement and breeding cycles. Disrupted migration routes and barriers created by the rising sea levels could lead to isolation or fragmentation of populations, affecting their genetic diversity and long-term survival.

Furthermore, the change in the physical geography due to the separation could alter oceanic currents and water circulation patterns. This, in turn, would affect nutrient distribution and primary productivity in the water column, influencing the food webs and species interactions within the marine ecosystem. The availability of specific habitats, such as coastal wetlands and coral reefs, could also be affected, impacting the biodiversity and ecological services they provide.

For more such information on: biosphere

https://brainly.com/question/12467010

#SPJ8

Rotenone (An Insecticide) Blocks The Protein That Accepts Electrons From NADH. Rotenone Blocks ATP Synthesis By:
Rotenone (an insecticide) blocks the protein that accepts ele

Answers

Rotenone inhibits the electron transport chain (ETC) in the mitochondria, which is how it prevents ATP generation.

Rotenone specifically binds to the protein complex known as complex I (NADH dehydrogenase), which is responsible for transferring electrons from NADH to ubiquinone, a mobile electron carrier in the ETC. Rotenone blocks the flow of electrons through the ETC by interacting with complex I and preventing the transfer of electrons from NADH to ubiquinone. As a result, the proton motive force (PMF), which is typically produced by the passage of electrons through the ETC across the mitochondrial inner membrane, decreases.

The PMF is required for ATP synthase, a protein complex that harnesses the PMF's energy to drive the phosphorylation of ADP to ATP, to produce ATP. Rotenone's suppression of the ETC consequently causes a reduction in ATP synthesis.

Learn  more about “ Rotenone   “ visit here;

https://brainly.com/question/25254934

#SPJ4

complete question -

"Rotenone is an insecticide that is known to block the protein that accepts electrons from NADH. What is the mechanism by which rotenone blocks ATP synthesis?"

Why is caffeine used for heart rate experiments

Answers

Physiologically, caffeine mimics the effects of epinephrine, a sympathetic nervous system stimulant, which leads to an increased heart rate and respiration rate (Mahmud et al., 2001).

Organism Characteristics
Number of cells is UNICELLULAR.
Cell type is PROKARYOTIC.
Location found is UNDERWATER VOLCANO.

In which domain would the organism be classified?
Protista
Eukarya
Bacteria
Archae

Answers

Answer:I think Archaea.

Explanation:

Organism Characteristics with UNICELLULAR,  PROKARYOTIC and found in  UNDERWATER VOLCANO are Archae.

what are the characteristic features of Archae ?

Archaebacteria are the oldest living organisms on earth belong to the kingdom Monera  classified as bacteria.

These are distinct from prokaryotes share slightly common characteristics with the eukaryotes, they are obligate or facultative anaerobes, i.e., which flourish in the absence of oxygen

They can undergo methanogenesis, their cell membranes are composed of lipids, the rigid cell wall provides shape and support to the Archaebacteria.

Here the cell wall is made up of Pseudomurein,  prevents archaebacteria from the effects of Lysozyme and these Lysozyme is an enzyme released by the immune system of the host, which dissolves the cell wall of pathogenic bacteria.

These do not possess membrane-bound organelles like nuclei, endoplasmic reticulum, mitochondria, lysosomes or chloroplast.

For more details regarding Archae, visit

https://brainly.com/question/9162551

#SPJ2

1. Josie was given a set of cards that identify the hierarchical organization of organisms. She orders the cards from least complex to most complex. Which shows the cards in the correct order?

Answers

To determine the correct order of the cards representing the hierarchical organization of organisms from least complex to most complex.

The hierarchical organization of organisms typically follows a pattern from lower to higher levels, such as:

Cell: The basic unit of life, organisms are composed of one or more cells.Tissue: A group of similar cells working together to perform a specific function.Organ: A structure composed of different tissues functioning together to carry out specific tasks.Organ System: A group of organs that work together to perform a particular function or set of functions.Organism: A complete, individual living being composed of various organ systems working in coordination.

If you have a set of cards representing these hierarchical levels or a similar set, the correct order would be:

CellTissueOrganOrgan SystemOrganism

Please provide more specific information or the actual cards in order to confirm the correct order based on the given set.

for similar questions on hierarchical organization.

https://brainly.com/question/10815413

#SPJ8

State one substance that leaves the blood as it flows through the tissues of the small intestine.

Answers

Answer:

Superior mesenteric artery.

The primary source of energy for the body is a form of sugar called glucose. It travels to cells all throughout the body after being absorbed into circulation from the small intestine.

Other chemicals that enter the circulation through the small intestine include the following:

Proteins' building components are amino acids.

The lipids' building components are fatty acids.

minerals and vitamins

Water

In an adult, the small intestine is a muscular tube that is roughly 20 feet long. It is situated in the belly, above the large intestine, and below the stomach. The bulk of digestion and nutritional absorption from meals occurs in the small intestine.

To know more about glucose:

https://brainly.com/question/13555266

#SPJ2

Quagga mussels, an invasive species of mollusk originally from
Russia, have been introduced to the lake after being carried in on
the hulls of boats. An assessment of the size of the quagga
mussel problem is needed, along with suggestions to curb their
population growth.
what field of science is this?

Answers

This is a problem in the field of ecology.

The problem of quagga mussels in the lake is an ecological issue that requires scientific assessment and management.

It falls under the discipline of ecology, which studies the relationships between organisms and their environment.

Ecologists investigate the impacts of invasive species on the ecosystem and devise strategies to control their spread and minimize their effects.

In this case, scientists will need to examine the size of the quagga mussel population, their distribution, and their ecological interactions with native species.

They will also need to recommend measures to prevent further introduction of quagga mussels and to manage their population growth, such as using chemical treatments or biological controls.

For more such questions on ecology, click on:

https://brainly.com/question/842527

#SPJ11

What are staphylococci

Answers

Eh...

Based off what I know, it is any of several spherical bacteria of the genus Staphylococcus, occurring in pairs, tetrads, and irregular clusters, certain species of which, as S. aureus, can be pathogenic for humans.

Thanks!

Answer: I hope this is helpful mark me brainlist if correct then no if wrong Happy Thanksgiving

Explanation:

staphylococcus- a bacterium of a genus that includes many pathogenic kinds that cause pus formation, especially in the skin and mucous membranes.Staphylococcus is a genus of Gram-positive bacteria in the family Staphylococcaceae from the order Bacillales. Under the microscope, they appear spherical, and form in grape-like clusters. Staphylococcus species are facultative anaerobic organismsStaphylococcus (staph) is a group of bacteria. There are more than 30 types. A type called Staphylococcus aureus causes most infections. Staph bacteria can cause many different types of infections, including: Skin infections, which are the most common types of staph infections.

(20 points) {brainliest} PLEASE HELP ME <3

How does a type II restriction enzyme generate blunt ends?

A. It cuts both strands in the middle of a recognition site.
B. It cuts only one strand up to 25 base pairs away from the recognition site.
C. It cuts both strands to have unpaired nucleotides.
D. It cuts only one strand in the middle of a recognition site.

Answers

Answer:

Type II restriction enzymes are the familiar ones used for everyday molecular biology applications such as gene cloning and DNA fragmentation and analysis. These enzymes cleave DNA at fixed positions with respect to their recognition sequence, creating reproducible fragments and distinct gel electrophoresis patterns. Over 3,500 Type II enzymes have been discovered and characterized, recognizing some 350 different DNA sequences. Thousands more ‘putative’ Type II enzymes have been identified by analysis of sequenced bacterial and archaeal genomes, but remain uncharacterized.

Explanation:

I hope this is right I need a brainlest.

9. The probability that a boy whose mother is heterozygous for a sex-linked trait having the trait is:



10. The probability that the daughter of a mom with a dominant disease-causing allele on the X chromosome and a dad with the disorder will be affected with the disorder is:



11. An unaffected man and an unaffected woman have a son with Lesch-Nyhan syndrome, an X-linked recessive trait. What are the chances that a daughter of this couple will inherit Lesch-Nyhan syndrome?



12. A man has the X-linked dominant condition CGH that produces dense hair on the face and upper body. What is the chance that he will pass it on to his daughters?

Answers

Answer:

Explanation:

   The probability that the daughter of a mom with a dominant disease-causing allele on the X chromosome and a dad with the disorder will be affected with the disorder is 100%. This is because the daughter will inherit one X chromosome from the mom, which carries the dominant allele that causes the disorder, and one X chromosome from the dad, which is affected by the disorder.

   Since the parents are unaffected, we can infer that they are both heterozygous carriers of the Lesch-Nyhan syndrome allele. If they have a son with the syndrome, we know that the son inherited the recessive allele from both parents. The chance that a daughter of this couple will inherit Lesch-Nyhan syndrome is 25%. This is because the daughter will inherit one X chromosome from the father, which does not carry the recessive allele, and one X chromosome from the mother, which has a 50% chance of carrying the recessive allele.

   Since the condition is X-linked dominant, the man will pass on the dominant allele to all of his daughters. Therefore, the chance that he will pass it on to his daughters is 100%.

Why does the American government strongly oppose the beliefs of communism?

Answers

Explanation:

Anti-communism is a communist-opposed popular organization and philosophy. It's been The United states Labor Union has long been heavily anti-communist. The Parliament, which is more leftist.   In Russia, imperialism. Richard Wurmbrand spoke about his memories of being persecuted in Communist Moldova because of his religion.

Other Questions
At a grocery store, 4 pounds of candy costs $12. If he has $15 how many pounds of these candy can he buy? Which idea is correctly paired with a document that supports it? *1 pointcolonialism The Princemilitarism Sadler Reportcapitalism Wealth of Nationsmonotheism The Communist Manifesto A random sample of 110 observations produced a mean of x=35.9 from a population with a normal distribution and a standard deviation =4.75.(a) Find a 90% confidence interval for (b) Find a 95% confidence interval for (c) Find a 99% confidence interval for Discuss the main contributions of 1 economist that influenced by John Maynard Keynes (Keynesianism, Post-Keynesianism, Neo/New-Keynesianism, New Classical) to economic thought. Why do you think his/her economic ideas are important, according to your own perspective? if demand is elastic, a decrease in price causes: a. no change in total revenue. b. a decrease in total revenue. c. an increase in quantity, but anything can happen to revenue. d. an increase in total revenue. Compare |-5| and |3| cash receipts a firm has actual sales of $70,000 in april and $61,000 in may. it expects sales of $71,000 in june and $96,000 in july and in august. assuming that sales are the only source of cash inflows and that half of them are for cash and the remainder are collected evenly over the following 2 months, what are the firm's expected cash receipts for june, july, and august? There are 8 white marbles and 4 green marbles in a bag express the ratio of green marbles to white marbles as a fraction reduced to lowest term?What is the answer What is the average time for the toy car to move 1.0 m on tile? 20.2 s 24.4 s 28.1 s 60.7 s why does your body need a communication system? On page 128, Esperanza is helping to shell almonds.The author describes an almond as "like two hands pressed together, protecting something inside." Then as Esperanza cracks one open the text says, "then pulled the meat from its defenses". How is the almond a metaphor for Esperanza? M/8-15=-12What would m equal?? 3. a laboring patient with twin gestations is admitted. the nurse knows that continuous electronic fetal monitoring is more advantageous than ia in this situation. what is the rationale for using continuous electronic fetal monitoring? Solve the simultaneous equationsx + y = 8-X + 3y = 12T =y = According to the text, how have America's Immigration policies changed over time? Which groupsof people have been discouraged from coming to America in the past, and why? How would youdescribe America's treatment of immigrants today? Did Britney Spears had a doomed or cursed beginning? The process through which a risk management system is populated with risk exposures is most likely known as:a) Risk capture.b) Risk identification.c) Risk governance. (100 Points And Brainlyest) The author of this passage chooses to describe four different playwrights in order to (5 points) convince the reader that one playwright is more talented than anotherinstruct the reader about the least successful adaptations of Shakespeareinform the reader of many different interpretations of the same two charactersdistract the reader from the true message of Shakespeare's tragic play A paint company claims their paint will be completely dry within 45 minutes after application. Recently, customers have complained drying times are longer than the claimed 45 minutes. A consumer advocate group takes a random sample of 25 paint specimens and records their drying times. The average drying time x is 52. Consider dryng time, for all test specimens, to be normally distributed with ? = 6.Suppose the claimed drying time is true, that is ? = 45 minutes, what is the probability of observing a sample mean of x = 52 or greater from a sample size of 25? (Round your answer to four decimal places.)