Answer:
C. ATP production in mitochondria
Explanation:
Bacterial cells do not possess mitochondria. Mitochondria are membrane-bound organelles found in eukaryotic cells and are responsible for ATP production through aerobic respiration. In contrast, bacterial cells generate ATP through processes such as glycolysis and the electron transport chain, which occur in the cytoplasm and the plasma membrane. Therefore, ATP production in bacteria does not involve mitochondria.
The other options listed, A, B, D, and E, are all characteristics or processes that can be found in bacterial cells. Bacterial cells can have flagella for swimming, possess a cell wall around the plasma membrane, produce proteins on ribosomes, and engage in processes like conjugation for the exchange of genetic material with other bacteria.
Learn more about mitochondria: https://brainly.com/question/22189295
#SPJ11
the origin of a new plant species by hybridizing two existing species, coupled with accidents during cell division, is an example of _____.
An indication of sympatric speciation is the creation of a new species of plants through the hybridization of two different species and errors that occur during cell division.
It is speciation that may occur under unique conditions, such as the splitting of two populations of the same species before a barrier must materialize to keep them apart.
This can occasionally occur when a species evolves into a new one, most frequently through a symbiotic interaction with both plant species.
Therefore, we may conclude that sympatric speciation, as per the research, enables a population of one species to inevitably lead to another by accumulating enough genetic variations.
Learn more about the salmonella epidemic at
https://brainly.com/question/4493180
#SPJ4
Question1:
What is aggregation with respect to OOP? – (1 mark) In your explanation you must:
- Differentiate between the two forms aggregation and composition. (1 mark each)
- Explain how they are shown in UML. – (0.5 marks each)
Question2:
Clearly explain the difference between an object and a class (you may use examples or diagrams to assist).
What is an access modifier and why is it important? -( 1 mark for its importance and usage)
In your explanation you must also indicate:
- The differences between public and private access modifiers. -(0.5 marks each)
How are they shown in a UML diagram. –(0.5 marks each)
Aggregation with respect to OOP is a technique of object composition that is employed when one object is a part of a larger object, but the smaller object may exist independently of the larger one. The primary difference between composition and aggregation is that in composition, the objects cannot exist independently of the composite object, whereas in aggregation, the objects may exist independently.
An object is an instance of a class, while a class is a template or blueprint for creating objects. An object is an instance of a class that contains all of the characteristics of the class, including its attributes and methods, whereas a class is the definition or representation of those attributes and methods
It is necessary to include the private keyword in the definition of a class, method, or variable to make it private. In UML diagrams, a plus symbol (+) is used to indicate a public method, while a minus symbol (-) is used to indicate a private method.
To know more about composition visit:
https://brainly.com/question/32502695
#SPJ11
which of the statements are true about the resting membrane potential? select all that apply. it results from the sodium-potassium pump moving more na ions out of the cell than k ions into the cell. it results from k ions diffusing out of the cell. it results from voltage-gated sodium channels remaining open for long periods of time.
The statement "it results from k ions diffusing out of the cell" is true about the resting membrane potential. The other two statements are false.
What is Diffusion?
Diffusion is the process by which molecules move from an area of high concentration to an area of low concentration, driven by the natural tendency of molecules to spread out and become evenly distributed. This occurs due to random thermal motion of particles, which causes them to move and collide with each other.
The resting membrane potential is the electrical potential difference across the plasma membrane of a cell when the cell is not conducting an impulse. It results from the concentration gradient and selective permeability of ions across the membrane.
Learn more about Diffusion
https://brainly.com/question/94094
#SPJ1
c) Suggest what can be done to address any discrepancy. Start explaining the most practical solution first and then the least favorable solution(s). Write in the provided box, please. [10 marks]
Answer:
Explanation:
yes cux it is good
and i needpoints
match the items. the task is to match the lettered items with the correct numbered items. appearing below is a list of lettered items. following that is a list of numbered items. each numbered item is followed by a drop-down. select the letter in the drop down that best matches the numbered item with the lettered alternatives. a. mitochondrial matrix b. oxygen c. mitochondrial inner membrane d. glycolysis e. 1 f. oxidative phosphorylation g. water h. cell membrane i. substrate-level phosphorylation j. 3 k. cytoplasm l. 4
Matching the items to the correct number list a. mitochondrial matrix b. oxygen c. mitochondrial inner membrane d. glycolysis e. 1 f. oxidative phosphorylation g. water h. cell membrane.
Substrate-level phosphorylation occurs in the cytoplasm of cells (glycolysis) and in the mitochondria (Krebs cycle). .
So. substrate level-mitochondrial inner membrane
Substrate-level phosphorylation is a metabolism reaction that results in the production of ATP or GTP by the transfer of a phosphate group from a substrate directly to ADP or GDP. Transferring from a higher energy (whether phosphate group attached or not) into a lower energy product.
The cytosol contains dissolved nutrients, helps break down waste products, and moves material around the cell. The nucleus often flows with the cytoplasm changing its shape as it moves. Cytosol is known as the matrix of the cytoplasm. It surrounds the cell organelles in eukaryotes.
Learn more about membrane here:-
brainly.com/question/26872631
#SPJ4
Where does lagging strand synthesis occur to the right of the dotted line?.
Lagging strand synthesis occurs on the right side of the dotted line during DNA replication. Here's a long answer that explains it in detail:DNA replication is a crucial process where the genetic material is copied during cell division. The process of DNA replication involves the synthesis of two new strands of DNA using the original DNA strand as a template.
The DNA double helix is unwound by DNA helicase to create two separated strands. These separated strands serve as templates for the synthesis of two new complementary strands.The leading strand is the strand that is synthesized in the 5' to 3' direction continuously by DNA polymerase. In contrast, the lagging strand is synthesized in the 3' to 5' direction in fragments called Okazaki fragments. The lagging strand is synthesized discontinuously, meaning that it is synthesized in small fragments that are later joined together by DNA ligase.
Both strands are synthesized in the 5' to 3' direction. However, since the lagging strand is synthesized in fragments, the direction of synthesis appears to be in the opposite direction of the replication fork movement.During DNA replication, the replication fork moves in a particular direction, creating a leading and a lagging strand. The leading strand is synthesized continuously in the direction of the replication fork movement, while the lagging strand is synthesized discontinuously in the opposite direction to the replication fork movement. Therefore, lagging strand synthesis occurs on the right side of the dotted line during DNA replication.
To know more about genetic material visit:-
https://brainly.com/question/14530382
#SPJ11
at thanksgiving dinner you surprise your family by telling them that a potato is a stem and not a root. assuming you had a microscope handy, what anatomical feature could you show them to prove it is a stem?
Distinct vascular bundles arranged in ring. potato is a dicot stem, dicot stem is a part of plant consisting of nodes, internodes. a distinguishing feature of diet stem is vascular bundles are arranged in a ring. Thus potato tuber is a stem, not root that helps in vegetative propagation. And this could be linked to Primordia.
How do you prove that potato tuber is a stem and not a root?In potato, the evidence of stem nature is by the presence of eyes on its brownish corky surface. It is a pit like structure and represents a node and axillary bud is present in it. Thus potato tuber is a stem, not root that helps in vegetative propagation.Potato is classified as a stem. Because it has many nodes known as eyes. The space between each eye is internodes. The potato eye grows into a shoot and a new plant.
Learn about potato tubers here: brainly.com/question/3797105
#SPJ4
bill, a physiology student at mpc wants to determine his blood type, so he took a few drops of blood from a puncture on his finger and mixes it with various antisera. his blood cells agglutinate when mixed with the anti-a sera but not with the anti-b or anti-d sera. this means:
A blood type can be defined as the classification of blood, based on the presence and absence of antibodies and inherited antigenic substances.
In the case of Bill to determine his blood type , means that :
Bill could not receive Type A negative blood in a transfusion.Bill could donate blood to an individual with type AB blood.Bill is Rh negative.Bill's plasma contains B antibodies.In our human body there are various types of blood level, moreover along with A and B antigens, there is a protein called the Rh factor, which can be either present (+) or absent (–), creating the 8 most common blood types (A+, A-, B+, B-, O+, O-, AB+, AB-).
To know more Blood types from the given link
https://brainly.com/question/15289194
#SPJ4
Plants can break large rocks into tiny pieces. How is it possible for plants to be able to mechanically weather rocks by breaking them into smaller pieces?
The roots of the plant grow into the cracks of the rock forcing the rock to break.
O The plant absorbs all the water from the soil leaving the rocks dry and brittle.
O The plant wraps itself around the rock and forces it to crumble.
The acidity of the plant forms new types of smaller rocks.
Answer:
The roots of the plant grow into the cracks of the rock forcing the rock to break.
Explanation:
Hope this helps
Which of these factors is least important in the design of a spaceship that will visit another planet?
F) the mass of the planet
G) the distance from Earth to the planet
H) the surface temperature of the planet
J) the size of the moons orbiting the planet.
Answer: J) the size of the moons orbiting the planet
Explanation: The least important factor in the design of a spaceship that will visit another planet is the size of the moons orbiting the planet (J). While the size of the moons may be interesting for scientific study, it has less direct impact on the design and functionality of the spaceship compared to factors like the mass of the planet (F), the distance from Earth to the planet (G), and the surface temperature of the planet (H).
A substitution mutation occurred and changed the 5th base in the DNA from a C to a T. Write the sequence of RNA codons that would result from this kind of mutation. **Separate each codon with a space. TACACGCAATTACCAGGGTAGCCATTGATT
The sequence of RNA codons resulting from the substitution mutation that changed the 5th base in the DNA from a C to a T is AUGUGCGUUAUCCAGGGUAGCCAAUUGA.
In DNA, the base C (cytosine) pairs with G (guanine), while in RNA, the base C pairs with G. However, due to the substitution mutation, the original C is replaced by a T (thymine) in the DNA sequence.
In RNA, thymine is replaced by uracil (U). Therefore, the RNA codons corresponding to the mutated DNA sequence can be derived by replacing each T with U and maintaining the sequence order.
The original DNA sequence TACACGCAATTACCAGGGTAGCCATTGATT would have the corresponding RNA codons AUGUGCGUUAUCCAGGGUAGCCAAUUGA. Each codon consists of three bases and represents a specific amino acid or a start or stop signal in the translation process of protein synthesis.
It's important to note that the given DNA sequence is provided as a single continuous string, and without additional information about the reading frame or specific gene sequence, it is not possible to determine the precise protein sequence or the functional implications of the mutation.
For more such answers on RNA
https://brainly.com/question/13939644
#SPJ8
Most designer drugs are meant to imitate the effects of painkillers true or false
Most designer drugs are meant to imitate the effects of painkillers. This statement is false because designer drugs are analogues of controlled substances developed to spoof the pharmacological effects of the original drugs.
Designer drugs are manufactured in a laboratory to imitate the effects of commonly abused illicit drugs. However, the chronic use and/or high doses of designer drugs have also been associated with such dangerous medical consequences.
An illicit drug is one that is an illegal drug that affects the human body. Non-medical use of drugs that are legally available such as pain killers, sleeping pills, etc., are the drugs which are also available but are very harmful if it is consumed in overdose.
Learn more about pain killers here
brainly.com/question/4346936
#SPJ4
Answer:
false
Explanation:
What are the function of areolar tissues ?
Areolar tissues are loose tissues that usually adhere to epithelia. Areolar tissues contain blood vessels(we know epithelial tissues don't have blood vessels). Their main role is to procure food for epithelial tissues.
What is the main challenge astronomers face when trying to directly detect black holes? (1 point)
Black holes are too black
Black holes are empty.
Black holes trap all light.
Black holes are too small.
Answer:
Black holes trap all light.
Explanation:
This temperature is on the order of billionths of a kelvin for black holes of stellar mass, making it essentially impossible to observe directly. Objects whose gravitational fields are too strong for light to escape were first considered in the 18th century by John Michell and Pierre-Simon Laplace.
Answer:
1. How do emission and reflection nebulae differ?
interactions with light
2. Where could scientists look to observe a black hole?
the center of the Milky Way
3. Which description best summarizes the steps that take place during black hole formation, in the correct order?
A massive star depletes its nuclear fuel; gravity overpowers the star; supernova occurs; core of star collapses.
4. Select the correct answer from the list.
To form a nebula, gravity pulls matter together or causes an explosion.
5. Which of these characteristics of a star make it most likely to become a black hole? Select the two correct answers
It is dying.
Its mass is greater than 20 times the mass of the sun.
6. Which statement best describes the galaxies closest to the Milky Way?
These galaxies include irregular, spiral, and elliptical types.
7. Select the correct answer from the list.
Astronomers think that most galaxies are centered by a black hole which exerts gravitational pull that binds the galaxy together.
8. What is the main challenge astronomers face when trying to directly detect black holes?
Black holes trap all light.
Explanation: I got 100%
study of cres of some genes from different species demonstrate that there can be substantial variation in these elements with little change in overall gene expression patterns. this is a good example of . quantitative traits epistasis cryptic genetic variation competitive binding
The study of cre elements in different species has revealed that there can be significant variation in these elements without causing a significant change in overall gene expression patterns. This is a good example of cryptic genetic variation, which refers to genetic variation that is not readily apparent in an organism's phenotype.
In this case, the variation in cre elements may not affect the expression of the gene in question, but it could still have an impact on other traits or functions that are controlled by the same or related genes. This highlights the importance of considering genetic variation beyond just the genes themselves, and taking into account the regulatory elements that control their expression.
It also underscores the complexity of genetic interactions and the potential for epistasis, or the way in which different genes can interact with each other to produce a particular phenotype. Additionally, competitive binding may play a role in this context, as the variation in cre elements could impact the ability of regulatory proteins to bind to the DNA and control gene expression. Overall, this is a complex and nuanced issue that requires a long answer to fully unpack.
To know more about genes, refer
https://brainly.com/question/19947953
#SPJ11
Among the themes targeted by the national academy of engineering's grand challenges for engineering as 'essential for humans to flourish' is?
Environmental sustainability is among the themes targeted by the national academy of engineering's grand challenges for engineering as 'essential for humans to flourish'.
What is Environmental sustainability?Environmental sustainability makes reference to the sustainable use of natural resources in order to protect the Earth's planet, which is a fundamental ecological issue.
In conclusion, environmental sustainability is among the themes targeted by the national academy of engineering's grand challenges for engineering as 'essential for humans to flourish'.
Learn more about Environmental sustainability here:
https://brainly.com/question/4677073
#SPJ1
explain the difference between lymph, tissue fluid and plasma
Lymph, tissue fluid, and plasma are all fluids that exist in the body, but they differ in their location and composition.
Lymph is a clear fluid that circulates through the lymphatic system. It is formed when tissue fluid enters the lymphatic vessels and is transported through the lymphatic vessels and lymph nodes. Lymph contains immune cells and waste products and is important for the immune system.
Tissue fluid is a fluid that surrounds the cells in tissues. It is formed when blood plasma filters out of the capillaries and into the spaces between cells. Tissue fluid supplies nutrients and oxygen to the cells and removes waste products.
Plasma is the liquid part of the blood. It contains water, electrolytes, proteins, hormones, and waste products. Plasma carries nutrients, hormones, and waste products to and from the cells and tissues in the body.
In summary, lymph is a fluid that circulates through the lymphatic system, tissue fluid is a fluid that surrounds the cells in tissues, and plasma is the liquid part of the blood that carries nutrients, hormones, and waste products to and from the cells and tissues in the body.
HELP !!
Which process that is necessary for cell
reproduction occurs during cell growth?
A: DNA replication
B: RNA replication
C: Dissolution of the cell membrane
D: The nucleus falls apart
Answer:
A: DNA replication
pls help? it’s due at 11:59
Answer:
The answer is 2 birds.
Explanation:
I got to this conclusion by drawing a Punnett square.
The punnet square is below:
t t
T Tt Tt
t tt tt
Therefore, the answer is 2 birds, with a fifty per cent chance of having the same recessive and a 50 per cent chance of having different dominant.
Note:
It didn't allow me to use the technical science terms for the 'same' and 'different' as the system thought they were inappropriate words.
9 One result of the ability of organisms to detect and appropriately respond to stimuli is
(1) an organ malfunction
(2) an allergic reaction
(3) dynamic equilibrium
(4) gene manipulation
One result of the ability of organisms to detect and appropriately respond to stimuli is dynamic equilibrium
What is response to stimuli?
Dynamic equilibrium, also known as homeostasis, depends on an organism's capacity to recognize stimuli and react correctly to them. The ability of an organism to control and maintain steady internal conditions despite changes in the environment is known as homeostasis.
Because of this dynamic equilibrium, organisms are able to modify their physiological functions and actions in response to a variety of inputs, including changes in temperature, light, sound, pressure, and chemical signals. It permits living things to adjust to their surroundings in order to secure their existence and welfare.
Learn more about stimuli:https://brainly.com/question/30714457
#spj1
A cork has a mass of 5 g and a volume of 10 mL. What is the density of the cork?
5/10 or 1/2
10/5 or 2
5x10 or 50
5+10 or 15
The density of the cork that has a mass of 5 g and a volume of 10 mL is ⁵/10 or ½ (option A).
How to calculate density?Density is the measure of the mass of matter contained by a unit volume. It can be calculated by dividing the mass of the substance by its volume as follows:
Density = mass (g) ÷ volume (mL)
According to this question, a cork has a mass of 5 g and a volume of 10 mL. The density of the cork can be calculated as follows:
Density = 5g ÷ 10mL
Density = ⁵/10 or ½ g/mL
Learn more about density at: https://brainly.com/question/952755
#SPJ1
true/false. "
In biofiltration of wastewater, air discharge from a treatment
facility is passed through a damp porous membrane that causes
contaminants to dissolve in water and be transformed into harness
products.
"
False. In biofiltration of wastewater, air discharge from a treatment facility is passed through a damp porous membrane that causes contaminants to dissolve in water and be transformed into harmless products.
This statement is wrong because, in biofiltration of wastewater, air discharge from a treatment facility is passed through a damp porous membrane that causes contaminants to dissolve in water and be transformed into harmless products.
Biofiltration is an air pollution control technology that uses microorganisms to break down pollutants into non-toxic substances. Biofiltration technology can be used for a variety of applications, including odour control, volatile organic compound removal, and hazardous air pollutant reduction. Biofilters, bio-scrubbers, and bioswales are all examples of biofiltration systems.
Biofilters are used in the biofiltration process to remove pollutants from the air. The biofilter is typically a fixed-bed or trickling filter that contains a moist organic media such as compost, soil, or peat. The pollutants are adsorbed onto the organic media's surface, where microorganisms such as bacteria, fungi, and algae break them down into non-toxic substances.
Biofiltration technology is being employed in wastewater treatment as well. In wastewater treatment, biofilters are used to remove contaminants from the water. Biofiltration is an environmentally friendly and cost-effective method of treating wastewater. Biofiltration aids in the removal of pollutants from the water. Biofilters are commonly used in wastewater treatment to remove organic pollutants such as nitrogen, phosphorus, and carbon compounds.
To learn more about biofiltration visit;
https://brainly.com/question/13495660
#SPJ11
In life cycles that alternate between haploid and diploid stages, ____________ acts to double the number of chromosome per cell from one set to two sets.
In life cycles that alternate between haploid and diploid stages, fertilization acts to double the number of chromosomes per cell from one set (haploid) to two sets (diploid).
In life cycles that alternate between haploid and diploid stages, fertilization acts to double the number of chromosomes per cell from one set to two sets.
In these life cycles, haploid cells (with one set of chromosomes) combine during fertilization to form a diploid cell (with two sets of chromosomes). This process ensures the alternation between haploid and diploid stages in the organism's life cycle.
To know more about diploid visit :-
https://brainly.com/question/27833793
#SPJ11
which characteristic is shared by extrusions, intrusions and faults
Answer:
Intrusions, extrusions of igneous rocks, and faults and gaps all share a common feature, that is, they help geologists and scientists in determining the relative age of rocks.
Explanation:
sorry for waiting for such a long time!
Brainlies plsss!
Answer:
all cause gaps in the geologic record
Explanation:
intrusions and extrusions are igneous rocks but a fault is a crack. These all cause gaps in the geologic record
(d) State the importance of mitosis in the growth of a multicellular organism, such
as a
flowering plant or a mammal.
Explanation:
Like other multicellular organisms, plants grow through a combination of cell growth and cell division. Cell growth increases cell size, while cell division (mitosis) increases the number of cells. As plant cells grow, they also become specialized into different cell types through cellular differentiation.
Plants make food; animals only ingest it.
Compare and contrast their digestive systems.
Include a) the structures involved in the digestive system of each and b) the processes
involved in creating their own food to the point of use in another organism
to use in an organism, in order.
The digestive systems of plants and animals are quite different. The primary difference is that plants are capable of producing their own food, while animals rely on outside sources. Plants take in carbon dioxide, water, and other nutrients and turn them into glucose and oxygen via photosynthesis.
Animals, on the other hand, must consume food to survive. The digestive system of plants includes a few structures and processes that are not present in animals, such as chloroplasts, which contain chlorophyll, and stoma, which regulate gas exchange. Plant Digestive System The primary function of a plant's digestive system is to convert light energy into chemical energy that can be used to fuel the plant's cellular processes.
The resulting glucose and oxygen are then used by the plant to fuel cellular processes and support growth.
Animal Digestive System : The animal digestive system, unlike the plant digestive system, is specialized for the consumption and breakdown of food. The digestive system of animals begins in the mouth, where food is taken in and begins to be broken down by enzymes in the saliva. The food then moves through the esophagus to the stomach, where it is further broken down by stomach acid and enzymes. The nutrients are then absorbed in the small intestine, while the waste products are eliminated in the large intestine.
Conclusion : In conclusion, the digestive systems of plants and animals are quite different. While both systems involve the absorption and use of nutrients, plants are capable of producing their own food, while animals must consume food to survive. Additionally, the structures and processes involved in each system are unique.
To know more about producing visit :
https://brainly.com/question/30141735
#SPJ11
scientists found fossils of 2 animals belonging to same species but occupy different regions. how is that possible?
a) animals migrated
b) they all roamed what was once one big continent
c) someone spread the fossils
d) a natural disaster forced them to seperate
The possibility that explains the presence of fossils of the same species in different regions is that the animals migrated. The correct answer is A.
Migration is a common phenomenon observed in various animal species. Animals move from one region to another in search of food, suitable habitats, or favorable environmental conditions.
This movement allows them to adapt to different environments and exploit available resources. As animals migrate, they can leave behind fossils in the regions they previously inhabited.
When animals belonging to the same species migrate to different regions, their populations become geographically separated.
Over time, the separated populations may undergo different evolutionary pressures, leading to the development of distinct traits and adaptations.
These changes can eventually result in the formation of different subspecies or even new species. Fossil evidence of the same species found in different regions supports the idea that migration played a role in the dispersal and distribution of these animals.
Therefore, the presence of fossils of the same species in different regions is indicative of past migration events and the subsequent divergence of populations. Therefore, the correct answer is A.
For more such answers on Population
https://brainly.com/question/29885712
#SPJ8
the most common reason that introduced species negatively impact an environment is because they
Disrupt the ecological balance and natural dynamics of the ecosystem. When introduced species are introduced into a new environment where they are not native, they can have significant negative impacts.
The most common reasons why introduced species negatively impact an environment include:
Competition: Introduced species can outcompete native species for resources such as food, water, shelter, and breeding sites. They may have competitive advantages over native species, such as faster growth rates, higher reproductive rates, or novel adaptations that allow them to thrive and dominate the ecosystem. This competition can lead to the displacement or even extinction of native species, disrupting the natural balance.
Predation and Predatory Release: Introduced species may lack natural predators or face reduced predation pressure in their new environment. They can prey upon or consume native species that are not adapted to defend against them. This can result in the decline or elimination of native species, disrupting the food web and causing cascading effects throughout the ecosystem.
Disease and Pathogens: Introduced species can carry new diseases, parasites, or pathogens that native species have no resistance or immunity to. This can lead to widespread disease outbreaks and population declines in native species, particularly when they have not evolved defenses against these novel diseases. Such diseases can cause significant ecological disruptions and even lead to the extinction of vulnerable species.
Habitat Alteration: Introduced species can modify or degrade habitats through their feeding habits, burrowing, or other activities. They may change vegetation patterns, soil composition, or water quality, thereby altering the habitat structure and making it less suitable for native species. This habitat alteration can result in reduced biodiversity and negatively impact the entire ecosystem.
Hybridization: When introduced species hybridize with native species, it can lead to genetic dilution or replacement of native populations. This can result in the loss of unique genetic traits and adaptations, reducing the overall genetic diversity and resilience of the native species.
It is important to note that not all introduced species have negative impacts, and some may even have positive effects on the environment. However, the potential negative impacts of introduced species highlight the importance of carefully managing and regulating the introduction of non-native species to protect native biodiversity and ecosystem functioning.
learn more about species
https://brainly.com/question/31960727
#SPJ11
Do the gradient levels and the sediment load increase or decrease as the
river ages?
As a river ages, the gradient levels typically decrease, while the sediment load may either increase or decrease depending on various factors.
The gradient of a river refers to the slope or steepness of its channel. Over time, as a river flows and erodes its surroundings, it tends to reach a state of equilibrium, where the slope becomes less steep. This is known as a decrease in gradient levels.
The sediment load of a river refers to the amount of sediment (such as sand, silt, and rocks) carried by the flowing water. It can vary based on factors such as the geology of the area, the climate, and the amount of erosion occurring in the river's watershed.
In some cases, as a river ages and continues to erode its surroundings, the sediment load may increase as more sediment is picked up and transported downstream. However, in other cases, the sediment load may decrease if the river reaches a point of balance where erosion and sedimentation are relatively equal.
Therefore, the change in sediment load as a river ages can vary depending on local conditions and the specific characteristics of the river.
For more such answers on sedimentation
https://brainly.com/question/9280527
#SPJ8
why is sun converted into chemical energy in the bonds of organic molecules?
Answer: The sun sustains all life on earth through photosynthesis, the process by which plants and other organisms convert the energy of sunlight into chemical energy, stored in the bonds of organic molecules. A central challenge of modern science is to replicate this process using synthetic catalysts, and thus produce solar fuels by artificial photosynthesis.
Explanation: