write any three methods of controlling flood landslide and soil erosion
Name and put the stages of a lytic infection in order. Then describe each stage.
A lack of CO2 in the flask would have caused reduced O2 production. If O2 , ATP, and NADPH are the by-products of the light-dependent phase of photosynthesis, how does a lack of CO2 cause reduced O2 production
Answer:
Carbondioxide is a reactant of photosynthesis.
Explanation:
Carbondioxide is a reactant of the process of photosynthesis and the product of photosynthesis is oxygen, if there is no or less carbondioxide the rate of photosynthesis decreases which leads to the lower production of oxygen. The rate of photosynthesis affected by the reactants available to it. If Carbondioxide is available in large amount more photosynthesis occurs that leads to more production of glucose as well as oxygen. So we can conclude that lack of Carbondioxide results in lower production of oxygen in the process of photosynthesis.
3a. Which paragraph is best illustrated by
the image?
How much of the parent DNA molecule makes up one daughter DNA molecule ?
Answer:
Watson and Crick discovered that DNA has a double helix shape, consisting of two polynucleotide chains held together by bonds between complementary bases. DNA replication is semi-conservative: half of the parent DNA molecule is conserved in each of the two daughter DNA molecules.
Explanation:
I looked it up lol
Which molecule allows a blade of grass to stand up straight?
O A. Polysaccharide
O B. Fructose
O C. Glucose
D. Monosaccharide
What characteristic of water causes it to display adhesion cohesion high specific heat capillary action
I think the answer should be the fact that water is a polar molecule.
This means it will attract other molecules which are polar (adhesion), including itself (cohesion).
I'm not sure about the last part of the question (high specific heat capillary action, the wording is a little confusing), but I think the reason why water has a high specific heat is the hydrogen bonds. Hydrogen bonding is the strongest kind of bond you can have in a molecule, so it would be harder to break those bonds, even with high heat.
Answer:
The polarity of water
which source has the widest range of residence time
Answer:
Underground water source
Explanation:
Underground water source has the widest range of residence time. Underground water are usually present deep under the ground and are formed from the rainfall seeping into the soil and remaining there. Evaporation takes a bit of the water and the remaining are usually present for a very long time.
Underground water residence time usually ranges between few weeks to a thousand years which depicts a very wide range.
in a culture of green alga that is carrying out photosynthesis in the presence of co2 in the laboratory, what would happen to the levels of ribulose 1,5-bisphosphate and 3-phosphoglycerate in the minutes after the lights were turned off and the cultures were plunged into darkness?
In the absence of light during photosynthesis, the levels of ribulose 1,5-bisphosphate decreases while the levels of 3-phosphoglycerate increases.
Photosynthesis is the process of synthesizing food by the plant by using the inorganic raw materials like sunlight energy, water and carbon dioxide and producing sugar as well as by-product oxygen. This process occurs in two phases: the light reaction and the dark reaction.
3-phosphoglycerate is the first product formed during the Calvin cycle in the carboxylation reaction. It accumulates in the absence of light because the plant has the constant source of carbon dioxide from the environment and ATP is no required for this reaction. However, for RUBP, regeneration ATP is required which will not be synthesized in the absence of light.
To know more about photosynthesis, here
brainly.com/question/1388366
#SPJ4
In humans, the ability to taste the bitter chemical PTC is controlled by a single gene. The tasting gene (T) is dominant to the non-tasting gene (t).
Which of the following genotypes is correctly labeled?
Choose 1 answer:
A
tT - heterozygous recessive
B
Tt - hom0zygous recessive
C
TT - hom0zygous dominant
D
tt - heterozygous dominant
Answer:
CORRECT (SELECTED)
TT - homozygous dominant
Explanation: Individuals with two tasting alleles are homozygous dominant.
1. A possible explanation for a set of
observations that must be tested is called a
A. theory.
B. law.
C. fact.
D. hypothesis
2 A well-tested explanation for a broad range of natural events is called a
A. Theory
B. Law
C. Fact
D. Hypothesis
which series is arranged in order from largest to smallest in size?
Answer:
Cell, Nulceus, Chromosome, DNA, Nucleotide
Explanation:
choose all that are components of a visceral reflex arc.
A visceral reflex arc is made up of the following cells: receptors, afferent neuron, interneuron, efferent neurons, and effector.
Reflex arc: what is it?In vertebrates, the majority of sensory neurons converge in the spinal column rather than passing directly into the brain. By turning on spinal motor neurons, faster reflex responses can be triggered without having to wait for signals to travel to the brain.
What are the five reflex arc steps?Reflexes function correctly every time with the aid of inhibitory interneurons. The five components of the reflex arc are the sensor, perception neuronal, central node, neuromuscular junction, and muscle, in that sequence. Knowledge is first detected throughout the sensor and then transmitted along sensory neurons in a reflex.
To know more about reflex arc visit:
https://brainly.com/question/3190796
#SPJ4
Which number remains unchanged during photosynthesis?
A. the number of water molecules
B. the number of carbon dioxide molecules
C. the number of glucose molecules
D. the number of carbon atoms
The number remains unchanged during photosynthesis is the number of carbon atoms.
Photosynthesis is a term to refer to the conversion of inorganic matter to organic matter thanks to the energy provided by sunlight.
This transformation is expressed in the following chemical function
6CO2 + 6H2O --sunlight -> C6H12O6 + 6O2.
As evidenced in the chemical function, the number of carbon atoms does not change because at the beginning and end of the reaction there are 6 carbons. However, other molecules such as water, glucose or carbon dioxide change as they degradate or combine with others.
Therefore, the correct answer is D. while options A, B and C are incorrect because they refer to elements that do change their number during this function.
Learn more in: https://brainly.com/question/797243
Which of the following occur during interphase? Select all that apply.
A) cells prepare for cell division
B) chromosomes divide
C) cytoplasm divides
D) cells grow rapidly
E) chromosomes replicate
Cells grow rapidly and hromosomes replicate are occurs during interphase.
What do you mean by interphase?Interphase is the portion of the cell cycle that is not accompanied by visible changes under the microscope, and includes the G1, S and G2 phases. During interphase, the cell grows, replicates its DNA and prepares for mitosis.
A cell spends most of its time in what is called interphase, and during this time it grows, replicates its chromosomes, and prepares for cell division. The cell then leaves interphase, undergoes mitosis, and completes its division.
Interphase is the longest part of the cell cycle. This is when the cell grows and copies its DNA before moving into mitosis. During mitosis, chromosomes will align, separate, and move into new daughter cells.
Learn more about interphase:
https://brainly.com/question/20223797
#SPJ5
A substitution mutation occurred and changed the 5th base in the DNA from a C to a T. Write the sequence of RNA codons that would result from this kind of mutation. **Separate each codon with a space. TACACGCAATTACCAGGGTAGCCATTGATT
The sequence of RNA codons resulting from the substitution mutation that changed the 5th base in the DNA from a C to a T is AUGUGCGUUAUCCAGGGUAGCCAAUUGA.
In DNA, the base C (cytosine) pairs with G (guanine), while in RNA, the base C pairs with G. However, due to the substitution mutation, the original C is replaced by a T (thymine) in the DNA sequence.
In RNA, thymine is replaced by uracil (U). Therefore, the RNA codons corresponding to the mutated DNA sequence can be derived by replacing each T with U and maintaining the sequence order.
The original DNA sequence TACACGCAATTACCAGGGTAGCCATTGATT would have the corresponding RNA codons AUGUGCGUUAUCCAGGGUAGCCAAUUGA. Each codon consists of three bases and represents a specific amino acid or a start or stop signal in the translation process of protein synthesis.
It's important to note that the given DNA sequence is provided as a single continuous string, and without additional information about the reading frame or specific gene sequence, it is not possible to determine the precise protein sequence or the functional implications of the mutation.
For more such answers on RNA
https://brainly.com/question/13939644
#SPJ8
Develop a multimedia presentation that summarizes the thesis and main points of your research paper on animal intelligence.
1. The presentation slides can be created using presentation software.
2. The presentation should include charts, graphs, video clips, animations, and/or audio clips.
3. The presentation should support a scripted oral presentation where you explain your thesis, or argument. Each presentation slide should include one subtopic and supporting details.
4. The end of the presentation should include an MLA-formatted list of sources (for the text and the visuals). MLA citations are required.
5. Use eye contact, gestures, and an appropriate tone.
6. Use language appropriate to the topic and audience.
7. Follow your teacher's guidelines for sharing the presentation.
The mental abilities of non-human animals, such as insect cognition, are included in the category of animal cognition. Comparative psychology was the foundation for the study of animal learning and conditioning that is applied in this discipline.
Animal cognition have shown evidence of cognitive skills like causal and logical reasoning, mirror self-recognition, deceit, symbolic communication, foresight, tool creation, and tool usage. The different ways that nonhuman animals can use animal cognition and learning mechanisms to address challenges in their surroundings. Although many animals possess unique cognitive skills that help them thrive in their unique settings, they do not frequently find solutions to new issues. Of course, some of them do, and we refer to them as intellectual, but none of them are as witty as we are. Chimpanzees are the closest surviving cousins to us, so it makes sense that they would rank among the most intelligent creatures in Animal cognition.
Learn more about Animal cognition
https://brainly.com/question/25718992
#SPJ9
Multimedia presentation that summarizes the thesis and main points of our research paper on animal intelligence can be made by including following points :
Intelligence is one of the characteristic features of being human and it comes in various forms. For example, there’s verbal-linguistic intelligence which is also known as communicative ability, spatial intelligence which is basically the ability to observe the world with the mind’s eye , logical-mathematical intelligence which is basically the ability to solve mathematical problems and emotional intelligence is known to be the ability to identify and manage your own emotions and the emotions of others. There are also many other types of intelligence which, in the process of understanding the workings of the human mind, we have tried to disentangle and define.
When we talk of Animal Intelligence, we talk in quite different terms. The study of animal intelligence has a long history. Ever since Darwin’s book titled as the Origin of Species was published, scientists have attempted to understand how animals think, comparing and contrasting this with human thought.
To know more about Animal Intelligence kindly check :
https://brainly.com/question/24219529
#SPJ9
Scientists have inserted a gene that codes for resistance to a biodegradable weed killer into a certain plant. Which of the following is the most likely benefit of the gene?
O The plant is more likely to survive when exposed to the weed killer
O The plant will be able to convert the weed killer into fertilizer.
O The plant will be able to produce chemicals to kill weeds around it.
O The plant is more likely to die when exposed to the weed killer.
QUICK PLEASE
Answer:
The plant is more likely to survive when exposed to the weed killer
Explanation:
since it has a gene that is resistant to the weed killer, it wont be affected by it.
resistant means it can defend itself from something
A science student makes the following statement: I think that plants grow faster in acidic soil than they do in normal soil. Which of these is the student doing? A. Conducting an experiment B. Developing a theory C. Drawing a conclusion D. Forming a hypothesis
D
You have created a hypothesis thus the answer is D
Eva investigates the number of daisy plants growing on the school playing field.
She uses a quadrat to count the number of daisy plants growing in different areas of the
field.
The table shows her results.
quadrat
1
2
3
4
number of daisy
plants
8
2
7
Each quadrat has an area of 0.25 m².
The school playing field has an area of 15000 m².
Estimate the population of daisy plants growing on the school field.
Eva investigates the number of daisy plants growing on the school playing field and uses a quadrat to count the number of daisy plants growing in different areas and the total number of plants in the field is 330,000.
What is the population density?
The population density explains the total number of individuals present in a given area, as the density of the population of an area may increase or decrease based upon the availability of foods and the climatic conditions.
Hence, Eva investigates the number of daisy plants growing on the school playing field and uses a quadrat to count the number of daisy plants growing in different areas and the total number of plants in the field is 330,000.
Learn more about the population density here.
https://brainly.com/question/1581160
#SPJ1
The question is incomplete, the complete question is the below
Eva investigates the number of daisy plants growing on the school playing field.
She uses a quadrat to count the number of daisy plants growing in different areas of the
field.
The table shows her results.
quadrat
1
2
3
4
number of daisy
plants
8
2
7
5
Each quadrat has an area of 0.25 m².
The school playing field has an area of 15000 m².
Estimate the population of daisy plants growing on the school field.
a)682
b)82500
c)330000
d)1320000
How would I explain the difference between preganglionic and postganglionic motor neurons? I'm learning about the PNS (peripheral nervous system) so what exactly does the postganglionic and preganglionic neurons do?
The primary distinction between preganglionic and postganglionic neurons is that preganglionic neurons arise from the central nervous system and supply the ganglia, whereas postganglionic neurons arise from the ganglia and supply the tissues.
What are motor neurons?Motor neurons are brain and spinal cord cells that allow us to move, speak, swallow, and breathe by transmitting commands from the brain to the muscles that perform these functions.
Acetylcholine is used by preganglionic neurons in the sympathetic and parasympathetic nervous systems, as well as postganglionic neurons in the parasympathetic nervous system (ACh). The sympathetic nervous system's postganglionic neurons use norepinephrine and epinephrine. However, there are some exceptions, as described below.
Learn more about neuron in:
https://brainly.com/question/13061744
#SPJ1
how can one primary mrna result in several polypeptrides with different amino acid sequences?
The primary mRNA is transcribed from a gene in DNA and contains a sequence of nucleotides that determine the amino acid sequence of a polypeptide.
However, the mRNA is not directly translated into a polypeptide. Instead, the mRNA undergoes processing before it is translated by ribosomes into a protein.
One of the most important steps in mRNA processing is called alternative splicing.
During alternative splicing, some sections of the primary mRNA are removed, and the remaining sections are spliced together in different ways.
This process allows for different combinations of exons (the coding sections of the mRNA) to be included or excluded from the mature mRNA.
As a result, a single primary mRNA can be spliced into different mature mRNAs, each with a different sequence of exons.
Each of these mature mRNAs can then be translated into a different polypeptide with a different amino acid sequence.
In summary, the process of alternative splicing allows a single primary mRNA to give rise to different polypeptides with distinct amino acid sequences.
To know more about primary mRNA refer here
https://brainly.com/question/9791055#
#SPJ11
What is the genotype of the F1 offspring when the true-breeding round seed plants and true-breeding wrinkled were crossed
The genotype of the F1 offspring when true-breeding round seed plants and true-breeding wrinkled seed plants are crossed can be determined by understanding the genetic concepts of dominant and recessive traits.
In this case, the round seed shape is the dominant trait, represented by the allele 'R', and the wrinkled seed shape is the recessive trait, represented by the allele 'r'. When true-breeding round seed plants (RR) are crossed with true-breeding wrinkled seed plants (rr), the F1 offspring will inherit one allele from each parent. Thus, the genotype of the F1 offspring will be heterozygous (Rr) for the seed shape.
This means that the F1 offspring will have one dominant allele (R) and one recessive allele (r). Due to the presence of the dominant allele, the phenotype of the F1 offspring will display the round seed shape. In summary, when true-breeding round seed plants (RR) and true-breeding wrinkled seed plants (rr) are crossed, the genotype of the F1 offspring is heterozygous (Rr), resulting in a round seed phenotype.
To learn more about allele here:
https://brainly.com/question/7602134
#SPJ11
What is the Liquid part of blood called?
Answer:
The liquid portion of the blood is called plasma.
Explanation:
hope this helps.
Ultraviolet light causes pyrimidine dimers to form in DNA. Some individuals are genetically incapable of repairing some dimers at "normal" rates. Such individuals are likely to suffer from:
Individuals who are genetically incapable of repairing pyrimidine dimers at normal rates are likely to suffer from increased risk of skin cancer and other DNA damage-related conditions. The accumulation of unrepaired pyrimidine dimers in the DNA can lead to mutations and genomic instability.
Pyrimidine dimers are formed when neighbouring pyrimidine bases (thymine or cytosine) on the same DNA strand create covalent connections with one another. This can happen as a result of UV light exposure, which causes the two nearby pyrimidine bases to chemically bond together. The most prevalent kind of pyrimidine dimer is a thymine dimer, which is created when two adjacent thymine bases form a covalent bond. This type of dimer alters the structure of the DNA and prevents normal DNA replication and transcription. Pyrimidine dimers have the potential to cause mutations and the formation of malignant cells if they are not corrected. Pyrimidine dimers can be repaired by cells using NER (nucleotide excision repair) and photolyase-mediated repair.
Learn more about Pyrimidine dimers here:
https://brainly.com/question/13959133
#SPJ11
help me please it’s due tomorrow
Answer:
James Watson and Francis Crick on 2.
TIME
01:49:16
Parkinson's disease is a brain disorder that may be caused by mutations in several genes that code for the production of
alpha-synuclein. Individuals who have Parkinson's disease exhibit symptoms such as uncontrollable tremors, difficulty
walking, and loss of coordination. How might geneticists determine where the mutations that cause Parkinson's disease
are located?
O PCR analysis
O gene mapping
O DNA fingerprinting
OSTR analysis
1
g
Cll
Gene mapping refers to the techniques used in molecular biology to determine the position of genes on the same chromosome. Gene mapping can be used to develop linkage analysis.
In this case, the geneticists can use GENE MAPPING techniques in order to determine the position of specific mutations that cause Parkinson's disease.Two or more genes are linked when they are close on the same chromosome, thereby being inherited as a unit (i.e., as a linkage block).Linkage analyses enable us to determine the position of linked genes on the same chromosome.Gene mapping techniques include the use of molecular markers whose segregation evidence the position of target genes to be mapped.Learn more in:
https://brainly.com/question/13769?referrer=searchResults
HELP PLS: NEED ANSWER ASAPPPPPPPPPPPP <3
1. Explain acid deposition. Your explanation should include the following:
• The sources of acid deposition
• The chemical equations involved in acid deposition formation
• An explanation of the types of acid deposition
• A discussion of the effects of acid deposition
• A drawing that shows the sources, formation, and precipitation of acid deposition
Acid deposition is the deposition of acidic compounds from the atmosphere to the Earth's surface. It is caused by natural sources like volcanoes and human activities such as burning fossil fuels. Chemical equations include \(SO_2\) + \(O_2\) + \(H_2O\) → \(H_2SO_4\) and NOx + \(O_2\) + \(H_2O\) → \(HNO_3\). Acid deposition can be wet or dry, harming ecosystems and causing damage to structures. The effects of acid deposition are far-reaching. It can lead to the acidification of lakes, rivers, and soils, which can harm aquatic ecosystems and affect the growth and survival of plants and animals. Acid deposition can also damage buildings, statues, and monuments made of limestone or marble, as these materials are particularly susceptible to erosion by acids.
Acid deposition refers to the deposition of acidic compounds from the atmosphere onto the Earth's surface.
Sources of acid deposition include natural sources like volcanic emissions and the oxidation of sulfur and nitrogen compounds, as well as human activities like burning fossil fuels.
The chemical equations involved in acid deposition formation are:
a. Formation of sulfuric acid: \(SO_2\) + \(O_2\) + \(H_2O\) → \(H_2SO_4\)
b. Formation of nitric acid: NOx + \(O_2\) + \(H_2O\) → \(HNO_3\)
Acid deposition can be classified into two types: wet deposition and dry deposition.
a. Wet deposition occurs when acidic pollutants dissolve in precipitation and are deposited onto the Earth's surface.
b. Dry deposition happens when acidic particles and gases settle directly onto the ground or other surfaces without being dissolved in precipitation.
The effects of acid deposition include the acidification of lakes, rivers, and soils, which can harm aquatic ecosystems and affect plant and animal life. It can also cause damage to buildings, statues, and monuments made of limestone or marble.
A visual representation of the sources, formation, and precipitation of acid deposition can be illustrated through a diagram or drawing. This can show the emission sources, chemical reactions, and the deposition of acidic compounds onto the Earth's surface.
For more such questions on Acid deposition click on:
https://brainly.com/question/30433113
#SPJ8
Which of the following is a main function of the circulatory system?
A.
To break down nutrients into a simpler form
B.
To transport oxygen to tissues throughout the body
C.
To send signals to the nervous system
D.
To produce hormones for reproduction
B. transport oxygen to tissues
In secondary succession, which happens first?
A. Soil is built
B. Grasses and other annual plants establish themselves.
C. Small shrubs establish themselves.
D. Wind brings lichens and mosses.
The first thing which happens in secondary succession is: (B) Grasses and other annual plants establish themselves.
Secondary succession is the establishment of life in a region where organisms existed earlier but vanished due to some natural disturbances like fire. The region in such case consists of some nutrients and soil and hence these need to be recycled to grow back life. Grasses and small plants can grow in such regions because they can grow in little nutrients conditions.
Annual plants are those which can complete their life cycle in an year. From germination to seed production, every process takes place within a year and such plants die off.
Therefore, the correct answer is option B.
To know more about annual plants, here
brainly.com/question/10581315
#SPJ4