Which of the following best explains why deforestation increases the risk of floods in an area? a. Tree leaves catch and retain rain water. B. Trees block the free flow of water. C. Deforestation increases precipitation. D. Tree roots improve soil water retention. Please select the best answer from the choices provided A B C D.

Answers

Answer 1
Tree roots improve soil water retention
Answer 2

Deforestation increases the risk of floods in an area tree roots improve soil water retention.

Why does deforestation result in higher flood risk?

When deforestation takes place, the top layer of soil can be dislodged – this is also known as soil erosion.

When the top layer of soil is unstable, it is unable to retain any of the water that falls on it, resulting in increased surface run-off, which, in turn, increases the risk of flooding.

Thus, option "D" is correct.

To learn more about deforestation click here:

https://brainly.com/question/17178423


Related Questions

fall and spring turnover of many lakes in temperate environments is important for a. benthic macroinvertebrate reproduction b. avoiding prolonged surface freezing of lakes c. mixing nutrients from bottom waters back into the lake d. reducing oxygen in deep lake waters e. c and d

Answers

Fall and spring turnover of many lakes in temperate environments is important for mixing nutrients from bottom waters back into the lake. The correct option is C.

Turnover in lakes refers to the mixing of the different layers of water in the lake, and it occurs in the fall and spring as a result of changes in water temperature.

Mixing nutrients from the bottom waters back into the lake is important because it redistributes nutrients that have accumulated in the bottom sediments back into the water column, where they can be utilized by phytoplankton and other organisms in the food chain. This is essential for maintaining the overall productivity of the lake ecosystem.

The correct option is C.

To know more about environments , click here.

https://brainly.com/question/30821114

#SPJ4

Which of the following types of organelle is most important in providing a cell with energy?
A.
mitochondria
B.
nuclei
C.
cell membranes

Answers

Answer: A-: Mitochondria

Explanation: It is also known as powerhouse of the cell. It produces ATP (Adenosine triphosphate). Mitochondria is having double layer of cell membrane enclosing the cytoplasm.

If sperm from one species cannot survive in the reproductive tract of another species, a type of prezygotic isolating mechanism called ______ isolation has occurred.

Answers

If sperm from one species cannot survive in the reproductive tract of another species, a type of prezygotic isolating mechanism called gametic isolation has occurred.

Gametic isolation is a reproductive barrier that prevents the fusion of gametes, or sex cells, from different species. This ultimately prevents the formation of a hybrid zygote, which is crucial for maintaining species boundaries.

Gametic isolation is important in the process of speciation, as it ensures that genetic material is not exchanged between different species, thus preserving their distinct characteristics. In many cases, gametic isolation arises due to biochemical differences between the gametes of the two species, which can include incompatibility of the sperm with the female reproductive environment or inability of the sperm to recognize and bind to the egg.

In summary, gametic isolation is a prezygotic reproductive barrier that prevents the mixing of genetic material from different species, thereby maintaining the distinctiveness of each species. This occurs when sperm from one species cannot survive or function properly in the reproductive tract of another species, thus preventing fertilization and formation of a hybrid zygote.

Learn more about Gametic isolation here: https://brainly.com/question/30580071

#SPJ11

sort the following protein complexes of the electron transport chain according to whether they are involved in pumping protons across the inner mitochondrial membrane or not. Drag the appropriate items to their respective bins.
- complex I
- complex II
- complex III
- complex IV- cytochrome C- coenzim Q

Answers

Protein complexes of the electron transport chain that Pumps protons : complex I, complex III, complex IV.

Protein complexes of the electron transport chain that Do not pump protons : coenzyme Q, complex II, cytochrome C.

In general, the ETC proteins are complex I, complex II, coenzyme Q, complex III, cytochrome C, and complex IV. Coenzyme Q (ubiquinone) is composed of a quinone and a hydrophobic tail. Its function is to act as an electron carrier, transferring electrons to complex III.

An electron transport chain is a collection of protein complexes and other molecules that use redox reactions to excite an electron from electron donors to electron acceptors while also transporting protons across a membrane. Electrons are transferred from one molecule to another in the electron transport chain, and the energy released during these electron carriers is used to form an electrochemical gradient. The stored energy in the gradient is used to produce ATP in chemiosmosis.

For more information on Electron transport Chain, visit :

https://brainly.com/question/24372542

#SPJ4

why do brain cells do brain things

Answers

They are building blocks of your brain, and transmit information to other neurons, muscles, and tissues throughout the body. They allow you to think, feel, move, and comprehend the world around you.

hope it helps...!!

Neurons release brain chemicals, known as neurotransmitters, which generate these electrical signals in neighboring neurons. The electrical signals propagate like a wave to thousands of neurons, which leads to thought formation. One theory explains that thoughts are generated when neurons fire.

Which nutrient is not typically included in an oral rehydration formula?
A. Salt
B. Water
C. CHO
D. Protein

Answers

The nutrient not typically included in an oral rehydration formula is: D. Protein

An oral rehydration formula is used to replenish fluids and electrolytes in cases of dehydration, such as from diarrhea or vomiting. These formulas are designed to provide a balance of water, electrolytes (including salts), and carbohydrates (CHO) to restore hydration and electrolyte balance in the body.

Protein (option D) is not typically included in oral rehydration formulas. While protein is an essential nutrient, it is not a primary component of oral rehydration solutions. The focus of oral rehydration formulas is primarily on fluid replacement and electrolyte restoration, particularly sodium, potassium, and sometimes other salts. Carbohydrates, typically in the form of glucose or similar sugars, are included to help facilitate fluid absorption and provide a source of energy.

It is worth noting that specific oral rehydration formulas may vary in their composition and may include additional components based on the specific needs of the individual or the condition being treated. However, in general, protein is not a typical component of oral rehydration formulas.

Oral rehydration formulas typically include salt (A), water (B), and carbohydrates (C, often referred to as CHO for carbon, hydrogen, and oxygen) to help replace lost electrolytes and fluids.

The correct answer is D. Protein.

Learn more about oral rehydration : https://brainly.com/question/15645961

#SPJ11

which structure is highlighted? a) adrenal gland
b) kidney
c) pancreas
d) spleen

Answers

Answer:

Which structure? is there a picture of diagram for refference?

Explanation:

Wild guess but I would go with spleen

Use the information provided to answer the question. The noniflower is a plant that grows in soil with a pH of 7.4 to 8. A variation of this species, called the mariflower, can grow at a more acidic pH. Researchers observed an area where noniflowers typically grow over a period of 50 years. Their data showed that the number of mariflowers slowly increased and the number of noniflowers slowly decreased. The impact of environmental factors on this trait shift was also documented. Environmental Factor Impact Increase in precipitation High Increase in number of factories in nearby areas High Change in temperature Low Change in length of days Low Introduction of invasive species Low 1. Explain why an increase in precipitation and in the number of nearby factories has a greater impact on the occurrence of the mariflowers than changes in temperature, length of day, and invasive species.

Answers

An increase in precipitation and nearby factories directly affect soil pH, favoring the growth of mariflowers over noniflowers.

The increase in precipitation and the number of nearby factories have a greater impact on the occurrence of mariflowers compared to changes in temperature, length of day, and invasive species due to their direct influence on the soil pH. Noniflowers, the original plant species, thrive in soil with a pH range of 7.4 to 8. However, mariflowers, a variation of the species, can grow in more acidic conditions.An increase in precipitation can lead to higher levels of soil moisture, which can promote the leaching of minerals and nutrients from the soil. This leaching can lower the soil pH, creating a more acidic environment that favors the growth of mariflowers.Similarly, the presence of nearby factories can release pollutants into the environment, such as sulfur dioxide or nitrogen oxide. These pollutants can undergo chemical reactions and form acidic compounds when combined with water. This can also contribute to soil acidification, providing favorable conditions for mariflower growth.In contrast, changes in temperature, length of day, and invasive species may indirectly impact the soil pH or have other ecological effects, but they do not directly affect the suitability of the soil for mariflowers as much as precipitation and nearby factory emissions do.

For more such questions on Mariflowers:

https://brainly.com/question/30067241

#SPJ8

The presence of organic material in soil makes it more productive for plant growth.

Please select the best answer from the choices provided

T
F

Answers

Answer:

True

Explanation:

Organic matter in the soil is called "humus". It is formed by the decomposition of plant material by microorganisms.

It is extremely important for retaining water and nutrients in the soil, both of which are crucial for plant growth and survival. Therefore, organic matter in the soil makes the soil much more "productive."

how is silk extracted from cocoons?​

Answers

The process of silk production is known as sericulture. ... Extracting raw silk starts by cultivating the silkworms on mulberry leaves. Once the worms start pupating in their cocoons, these are dissolved in boiling water in order for individual long fibres to be extracted and fed into the spinning reel.

what is the probability that a purebred monohybrid, dihybrid, three-factor cross or higher will lead to the expression of dominant phenotypes in first-generation offspring?

Answers

Each resulting genotype in the first generation of a purebred cross with any number of genes involved will be heterozygous for the genes, and each child will therefore exhibit the dominant trait.

What is heterozygous?The existence of two unique alleles at a specific gene locus. One normal allele, one mutant allele, or two separate mutant alleles may be present in a heterozygous genotype (compound heterozygote). You have a heterozygous genotype for that gene if the two copies differ.You may be heterozygous for hair colour if, for example, you have one gene for red hair and one allele for brown hair.Which qualities are expressed depends on the interaction between the two alleles. Heterozygous (Aa) individuals are not healthy carriers. Similar to homozygous dominant (AA) persons, they also have the condition despite appearing to be completely normal. Genetic counsellors frequently employ Punnett squares in their work.

To learn more about heterozygous, refer to:

https://brainly.com/question/1626661

#SPJ4

DO NOWHow areferritin andfunction forpomaryglycogen similar in theirOrganiom?anOrganism

Answers

Ferritin is found in hemoglobin that aids in the function of metabolism. Glycogen is a carbohydrate that consists of glycogen that can be hydrolyzed when needed. Both Ferritin and Glycogen function by storing the needed materials for the organism such as Human beings.

Which of these are long strands of DNA?
A. Chromosomes
B. Fossils
C. Genes
D. Mutations

Answers

Answer:

Chromosomes

Explanation:

A. Chromosomes
They are the long strands of DNA

what are 6 ethical concerns that people have about genetic modifications

Answers

Ethical concerns about genetic modifications include playing God, unintended consequences, inequality, genetic determinism, consent and autonomy, and a slippery slope of ethical boundaries.

Six ethical concerns regarding genetic modifications include:

1. Playing God: Genetic modifications raise concerns about humans taking on the role of manipulating and altering the natural genetic makeup of living organisms.

2. Unintended consequences: Altering genes may have unforeseen effects on individuals and ecosystems, potentially leading to unintended and harmful consequences.

3. Inequality: Genetic modifications could exacerbate existing social and economic inequalities if only certain individuals or groups have access to genetic enhancements.

4. Genetic determinism: Genetic modifications may perpetuate the belief that genes solely determine traits, disregarding the influence of environmental factors and individual agency.

5. Consent and autonomy: Questions arise regarding informed consent and the autonomy of individuals, especially in cases where genetic modifications are performed on non-consenting individuals, such as embryos or future generations.

6. Slippery slope: Concerns exist that genetic modifications could lead to a slippery slope where the boundaries of acceptable interventions are gradually pushed, potentially resulting in unethical practices.

In conclusion, the ethical concerns surrounding genetic modifications encompass playing God, unintended consequences, inequality, genetic determinism, consent and autonomy, and the potential for a slippery slope in ethical boundaries.

For more such questions on Genetic modifications:

https://brainly.com/question/16733706

#SPJ8

what scientist concluded that all animals aremade of cells

Answers

Answer:

Theodor Schwann and Matthias Jakob Schleiden

Explanation: in 1839 the two elucidated that all plants and animals were made up of cells

Please help me with this!!!!!!

Please help me with this!!!!!!

Answers

The correct answer should Be B
Hope that helped XD

Look at the map. Predict what will happen in Florida due to the jet stream.

A.) cooler temperature

B.) sea breeze

C.) warmer temperature

D.) land brezze
Answer is A

Answers

Cooler temperatures will be experienced in Florida due to the jet stream.

What will happen in Florida due to the jet stream?

If the jet stream flows in a southerly direction, it could bring cooler air from the north to Florida, leading to cooler temperatures.

Conversely, if the jet stream flows in a northerly direction, it could bring warmer air from the south to Florida, leading to warmer temperatures.

Sea and land breezes are typically influenced by local temperature differences between the land and water and are not directly related to the jet stream.

Learn more about jet streams at: https://brainly.com/question/791542

#SPJ1

DNA has two strands. If the sequence of nucleotides of one strand was known, is it possible to use that information to determine the sequence of the second strand? Explain your reasoning for your response using an example DNA sequence of at least 10 nucleotides with no consecutive letters that are the same.

Answers

It is possible to use the information of the nucleotide sequence of one strand to determine the sequence of the other strand.

Deoxyribonucleic acid (DNA) is a biological molecule with two strands. Each strand is made up of a sequence of nucleotides. The DNA nucleotides are Adenine (A), Cytosine (C), Guanine (G) and Thymine (T).

In a DNA molecule, Adenine forms an hydrogen bond with Thymine i.e. A-T, while Guanine forms an hydrogen bond with Cytosine i.e. G-C.

Therefore, it is possible to use the information of the nucleotide sequence of one strand to determine the sequence of the other strand. For example, a strand with ATGCGTACGAT will form the following sequence: TACGCATGCTA

Learn more: https://brainly.com/question/2823802?referrer=searchResults

A student used poster board to construct this model of a
section of DNA.
GATCGATC
||||||||
GATCGATC
a
Which statement describes this model of DNA?
O The model is accurate because it shows each base
splitting to form a double helix.
O The model is inaccurate because some typical bases
in DNA are missing.
O The model is inaccurate because the base pairs are
incorrect
O The model is accurate because it contains correctly
paired bases.
(
hp

Answers

The answer is C. The model is inaccurate because the base pairs are incorrect.

A fun way I remember how the bases pair with each other in DNA is A for apples, T for tree. A(adenine) and T(thymine) belong together, just as apples belong in trees. C is for car and G is for garage. C(cytosine) and G(guanine) belong together just as a car belongs in the garage. I hope this helped!

Compare freind vs acquaintence

Answers

Answer: A friend is someone that coincides with your principles and provides you with wisdom, honesty and loyalty in order to make you a better person. Friendship is a two way relationship. An acquaintance is someone you see possibly everyday at school or work or maybe you see every now and then through common activity.

Which answer is not a mechanism for evolution?

Answers

Random mutation is not an mechanism of evolution .

Five important factors for evolution mechanism are Natural Selection, genetic drift, gene flow, mutations, and non random mating. Through these process members of a population differs greatly in their traits.

Natural selection is the most important mechanism of evolution, other evolutionary mechanisms can also change the frequencies of traits in populations. These include mutation, genetic drift and migration. Natural selection have 5 basic and major components These are Variation (individual have variation in appearance and behavior ), Inheritance( traits are continuously passed on from parent to offspring), Selection, Time and Adaptation.

To learn more about Natural selection  , here

brainly.com/question/9830102

#SPJ1

what important feature of the small hive beetle life cycle differs dramatically from the life cycles of most other insect hive pests?

Answers

Small hive beetle is different in the larva stage than other hive insects. The dorsal spines and four additional pairs of less-developed abdominal legs of small hive beetle larvae differ from the other insect hive pests.

Mature larvae have three pairs of legs close to the head, are 3/8 inch (9.5-11 mm) in length and 1/16 inch (1.6 mm) wide, and are pearly white to beige in color. They have two big spines sticking out from the back and distinct rows of body spines. When closely inspected, the SHB larva can be recognized from the wax moth larva (Galleria melonella) by their body spines and the fact that they only have three pairs of legs close to the head. Wax moth larvae can treble the size of SHB larvae and contain four additional pairs of less-developed abdominal legs. They also lack body spines.

In addition, although SHB larvae don't make any webbing and frequently gather in corners, wax moth larvae do so in combs and can be found all around the hive.

Pupae are 5 mm long and range in color from creamy white to light brown. As they age, they become darker.

To learn more about the beetle population please click on the given link: https://brainly.com/question/26450468

#SPJ4

in your own words what is meant by the term – dna is antiparallel in arrangement

Answers

The term "DNA is antiparallel in arrangement" refers to the fact that the two strands of the DNA molecule run in opposite directions. This arrangement is critical to the stability of the DNA molecule and allows for correct hydrogen bonding between the nitrogenous bases on each strand.

DNA, or deoxyribonucleic acid, is a molecule that contains genetic information in living organisms. The structure of DNA is made up of two long strands of nucleotides that are arranged in a helical shape. The term "DNA is antiparallel in arrangement" refers to the orientation of these two strands in relation to each other.

To understand the concept of antiparallel arrangement in DNA, it's important to first understand the structure of a nucleotide. A nucleotide is made up of a nitrogenous base (adenine, thymine, guanine, or cytosine), a sugar molecule (deoxyribose), and a phosphate group. The nitrogenous base of one nucleotide pairs with the nitrogenous base of another nucleotide on the opposite strand through hydrogen bonds, creating the rungs of the DNA ladder.

In an antiparallel arrangement, the two strands of DNA run in opposite directions. One strand runs in a 5' to 3' direction (5-prime to 3-prime), while the other runs in a 3' to 5' direction (3-prime to 5-prime). This means that the orientation of the sugar-phosphate backbone of each strand is opposite to each other. In one strand, the 5' end of the sugar molecule is attached to the phosphate group, while the 3' end of the sugar molecule is free. In the other strand, the 3' end of the sugar molecule is attached to the phosphate group, while the 5' end is free.

This antiparallel arrangement is critical to the stability of the DNA molecule. The hydrogen bonding between the nitrogenous bases of the two strands can only occur if the strands run in opposite directions. If both strands ran in the same direction, the nitrogenous bases would be unable to pair up correctly, and the DNA molecule would be unstable.

Here you can learn more about DNA

https://brainly.com/question/264225#

#SPJ11

If a cell has 24 pairs of chromosomes in its diploid state, how many
chromosomes will it have after Meiosis 2?
A. 12
B. 24
C.48
D. 6

Answers

Answer:

option A is correct that is 12

Explanation:

meiosis occur in two phases in first phase DNA replication occur and amount of DNA become doubled without any change in the chromosome number and two daughter cell (each 2 n)are formed.

now in stage 2 each daughter cell undergoes mitosis with the formation of two cells with half chromosomes(n)

now 2n=24

n=24/2 =12

after meiosis stage 1...........two daughter cell each with  24 chromosomes

stage 2 .............each daughter cell form two grand daughter cell each with 12 chromosomes

net result.......4 daughter cell each with 12  chromosome(assuming cell as a diploid cell)

If a cell has 24 chromosomes before cell division then the daughter cell resulting from the mitotic division will have 24 chromosomes while the daughter cell resulting from the meiotic division will contain 12 chromosomes each.

The answer is option A.

What are meiotic and mitotic cell divisions?

There are sorts of cell departments: mitosis and meiosis. most of the time whilst humans discuss “cellular division,” they suggest mitosis, the procedure of making new frame cells. Meiosis is the sort of cell division that creates egg and sperm cells. Mitosis is an essential technique for lifestyles.

Learn more about mitosis and meiosis here: https://brainly.com/question/11842063

#SPJ2

Which of the following relationships is symbiotic?

A group of ants work together to build an underground nest.

A tick latches on to the body of a dog and feeds on the dog's blood.

Abee pollinates a flower while feeding on the flower's nectar.

A remora attaches to the body of a shark and feeds on scraps when the shark eats.

Two male red-winged blackbirds fight over territory.

A male bluebird and a female bluebird provide care for their offspring.

Which of the following relationships is symbiotic?A group of ants work together to build an underground

Answers

It should be box 1 3 5

DID ANYONE HEAR ABOUT THE NEW PLANET IN THE SOLAR SYSTEM!!!!!!!!!!
ITS CALLED PLANET X or the 9TH PLANET!!! GO CHECK IT OUT!!!!!!!!!

Answers

Answer:

No way! planet 9 finnaly found!

Explanation:

Which phylum of worms has a true circulatory system?NoneAnnelidaPlatyhelminthesNematoda

Answers

Annelida possess a closed circulatory system. They have a muscular pumping hearts. The blood moves through the capillaries to be carried to the cells of the body.

Platyhelminthes does not have a circulatory system. They have limited way to carry oxygen to the rest of the cells of the body.

Nematoda also does not have a circulatory system but possess a complete digestive system. They use diffusion in order to breathe.

Answer - Option 2 - Annelida

Help ASAP!!! You’ll get brainiest if you do it right!

What is the complementary DNA strand TAC GGC CGT TAT

Answers

the answer should be ATG CCG GCA ATA

Answer:

1a. The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’

(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)

b. The coding DNA strand, which is complementary to the template strand, is 5’ ATGGCAACCCAGGGTAGTTTG 3’

c. The sequence of the mRNA is 5’ AUGGCAACCCAGGGUAGUUUG 3’

(the sequence of the mRNA is complementary to the template strand and identical to the coding strand with U substituted for T)

d. The third codon is 5’ ACC 3’. Therefore, the corresponding anti-codon is 5’ GGU 3’

Position (m)
12
10
8
6
4
2
0
Position vs Time
2
4
6
Time (s)
8
10
12
Based on the graph, describe what is happening
between 4 and 6 seconds.
The object is moving away from the startata
constant speed.
The object is not moving.
The object is returning to the start at a constant
speed.
The object is changing speed.

Answers

Based on the graph, between 4 and 6 seconds time intervals, the object is stationary and not moving.

Between 4 and 6 seconds, according to the given position vs. time graph, the object's position remains constant at 4 meters. This means that there is no change in the object's displacement during this time interval, indicating that it is not moving.

The flat line on the graph between these two points indicates a steady position, suggesting that the object has come to rest or is stationary.

There is no indication of acceleration or velocity changes during this period, reinforcing the conclusion that the object is at a standstill. Therefore, the object is not changing its position or speed and can be described as not moving between 4 and 6 seconds.

For more such questions on time intervals: https://brainly.com/question/479532

#SPJ11

27. Some operons have both a positive and negative control mechanism built into the DNA sequence of the operon. That means both an activator protein and a repressor protein are present simultaneously. Consider a system that has both positive and repressible negative controls. a. Describe the four combinations of active or inactive regulatory proteins that could be present at any time in the cell. b. Draw diagrams similar to those in Models 1–3 to show each of the combinations in part a. (Divide the work among group members so that each member is drawing one diagram.) c. c. Label each of the combinations in part b as "operon on" or "operon off." d. Describe in complete sentences the cellular environment(s) that would turn the operon "on."

Answers

Hi there! I'm happy to help with your question.

a. In a system with both positive and negative control mechanisms, there are four combinations of active or inactive regulatory proteins that could be present:

1. Active activator protein and inactive repressor protein
2. Active activator protein and active repressor protein
3. Inactive activator protein and inactive repressor protein
4. Inactive activator protein and active repressor protein

b. As a text-based AI, I'm unable to draw diagrams directly. However, I can help describe the diagrams for each combination:

1. Diagram 1: Show the DNA sequence of the operon with an active activator protein bound to the activator binding site and no repressor protein bound to the operator site.
2. Diagram 2: Show the DNA sequence of the operon with an active activator protein bound to the activator binding site and an active repressor protein bound to the operator site.
3. Diagram 3: Show the DNA sequence of the operon with no activator protein bound to the activator binding site and no repressor protein bound to the operator site.
4. Diagram 4: Show the DNA sequence of the operon with no activator protein bound to the activator binding site and an active repressor protein bound to the operator site.

c. Label each of the combinations in part b as "operon on" or "operon off":

1. Operon on
2. Operon off
3. Operon off
4. Operon off

d. In the cellular environment that would turn the operon "on," there should be a condition that promotes the binding of the activator protein to its binding site and prevents the repressor protein from binding to the operator site. This typically occurs when a specific substrate or co-factor is present in the cell, which binds to the activator protein and/or the repressor protein, modifying their structures and regulating their activities accordingly.

To know more about the above please click:-

https://brainly.com/question/31494396

#SPJ11

Other Questions
Do you have a quotes of calld out by barba kinsover. Which is a major theme from The Land?O Power corrupts the people who have it.O Though they try, people are never truly free.Inequality hurts a wide variety of people.Tradition outweighs the progress of people. Question 8 (1 point)Solve the equation. Check for extraneous solutions.7|14-8x|= 2x + 2; the of decision making recognizes that people (a) often use incomplete and imperfect information, (b) are constrained by bounded rationality, and (c) tend to satisfice. which of the following terms are associated with byzantine art or architecture? aniconic, arabesque iconoclasm, aniconic arabesque, icon icon, iconoclasm If 420 cal of heat are added to a system, how much energy hasbeen added in joules?= ___________ J Scientists use satellites in space to monitor and record the infrared radiation given off by Earth. In which of the following examples would a scientist most likely be using this kind of data?to study the area of land flooded by a tsunamito study the rate of cloud formation over a certain continentto study the difference between the temperatures at Earth's polesto study the movement of continental plates beneath Earth's surface Simplify: \( \frac{\cot x}{\sec x}+\sin x \) Select one: a. \( \csc x \) b. \( \sec x \) c. \( 2 \sin x \) d. \( 2 \cos x \) e. 1 interpret sample c. based on the sedimentary structure you identified in the previous question, what interpretive statement can you make about the conditions under which this sediment was deposited? activity in the prefrontal cortex is most likely____correlated with gains in a laboratory gambling task. Read and select the correct option.1)Soy Eduardo; yo barro la sala.2)Soy Eduardo; yo barre la sala.3)Usted, seor Matt, preparo el comedor.4)Usted, seor Matt, preparas el comedor. Steps are made up of a tread that you can step on,and a rise, which is the height. On the steps shown,the tread is 14 inches and the rise is 5.5 inches. Ifthe concrete used to make the steps cost $2.78 percubic foot, what was the cost of the concrete forthese steps to the nearest dollar?Show or explain how you figured out your answer.0Rise 5.5.In.Tread 14 in.3 feet- If sin = x and tan = y, find cos can someone help me plz Look at the rectangle and the square:A rectangle PQRS and square LMNO are drawn side by side. The length SR of the rectangle is labeled as 14 inches, and the width QR is labeled as 7 inches. The side LM of the square is labeled as 7 inches.Anna says that the length of diagonal SQ is two times the length of diagonal OM.Is Anna correct? Justify your answer and show all your work. Your work should state the theorem you used to find the lengths of the diagonals. In what way did the mayflower compact provide an important step in the growth of representative government in the english colonies?. At Midtown University, the average weight of freshman boys is 170 lbs with a standard deviation of 9 lbs. The average weight of freshman girls is 115 lbs with a standard deviation of 6 lbs. As new distribution is to be formed from the valued obtained when the weights of the girls and the boys are added together. What are the mean and standard deviation of this new distribution? Assume that the weights of boys and girls are independent What do you call the second degre function? I NEED THIS QUICKLY ONLY HAVE 10 MINUTES LEFT!!1. It takes the earth 24 h to complete a full rotation. It takes Mercury approximately 56 days, 12 h, and 40 min to complete a full rotation. How many hours does it take Mercury to complete a full rotation? Show your work using the correct conversion factors. Not telling the truth is an example of which ethical principle? Utilitarianism, universalism, rights, justice, virtue ethics