What might have prevented the fall of the aztec empire and other civilizations like it in the americas?.

Answers

Answer 1

Indeed. The future is not entirely settled by what we do (take).

Your unrestrained choice can defer your destiny, yet you can't transform it.

What occurred in the Fall of the Aztecs?

1. Regardless of whether you've been covering your head for some time, destiny will continue to thump on your entryway until you're prepared to arrive up and invite it. Destiny keeps on trusting in you. What is planned for you can't be lost, yet it very well may be deferred.

2. They most likely could never have fallen as fast or as definitely on the off chance that conquerors hadn't brought infection and weaponry.

Find out about Aztec Empire here:

https://brainly.com/question/19389723

#SPJ4


Related Questions

What was an effect of the Kansas-Nebraska Act? The violence in Kansas and Nebraska caused by the issues surrounding enslavement ended. The Republican Party was created as an anti-slavery party. John Brown was elected governor of Kansas for his role in dividing up the territory. Congress finally ended the debate over enslavement and moved on to explore the issues of tariffs.

Answers

Answer:

The Republican Party was created as an anti-slavery party

Explanation:

The Republican Party emerged in 1854 to combat the Kansas–Nebraska Act and the expansion of slavery into American territories. The early Republican Party consisted of northern Protestants, factory workers, professionals, businessmen, prosperous farmers, and after 1866, former black slaves.

campaign in a sentence

Answers

I love you baby but I’m playing cod campaign

What comparison does Roosevelt make as he concludes his speech? What is his point in doing so?

Answers

The comparison that Roosevelt make as he concludes his speech is the universal freedom of people to that of the freedom that Americans have. The point in doing so is to let the Americans see the reason to fight the w.a.r. for the Britain and the rest of the world.

In his Annual Message to Congress (State of the Union Address) on January 6, 1941, Franklin Roosevelt presented his reasons for American involvement, making the case for continued aid to Great Britain and greater production of war industries at home. In helping Britain, President Roosevelt stated, the United States was fighting for the universal freedoms that all people possessed.

Who is Roosevelt?

Franklin Delano Roosevelt is often referred to by his initials FDR, was an American politician and attorney who served as the 32nd president of the United States from 1933 until his death in 1945.

Therefore, the correct answer is as given above

learn more about Roosevelt: https://brainly.com/question/2066305

#SPJ1

Answer:

What comparison does Roosevelt make as he concludes his speech?

The comparison that Roosevelt makes as he concludes his speech is the universal freedom of people to that of the space that Americans have. The point in doing so is to let the Americans see why to fight the war for Britain and the rest of the world.

What is his point in doing so?

In his Annual Message to Congress (State of the Union Address) on January 6, 1941, Franklin Roosevelt presented his reasons for American involvement, making the case for continued aid to Great Britain and greater production of war industries at home. In helping Britain, President Roosevelt stated, the United States was fighting for the universal freedoms that all people possessed.

What US State was the first to recognize girls Flag Football as a high school varsity sport?

Answers

Answer:

Florida in 2003

this 1968 rolling stones album was the last by the band to feature brian jones as well as the first to feature mick taylor.

Answers

Answer:

b

Explanation:

Choose the answers that correctly identify similarities between the Greek polis and Roman civitas.
A)
Both allowed women to attain citizenship.
B)
The social classes of both included slaves.
C)
The cities of both were separated by hills.
D)
Both produced art that promoted an ideal form.
E)
The economies of both were based on agriculture.

Answers

Answer:

The answer is b hope this helps :)

Explanation: it should be the right answer sorry if I’m wrong genuinely

During the War of Independence, nearly every state increased importation of slaves from Africa. T/F

Answers

False. During the War of Independence, not every state increased importation of slaves from Africa. The statement implies a general increase in slave imports across all states, which is incorrect.

While it is true that some states continued or even increased their involvement in the slave trade during this period, there were also states that took steps to restrict or abolish the importation of slaves. These efforts were motivated by various factors, including moral objections to slavery, economic considerations, and the ideals of freedom and equality espoused during the Revolutionary War.

During the American Revolution, several northern states, such as Vermont, Pennsylvania, and Massachusetts, passed legislation to gradually abolish or restrict the importation of slaves. Vermont, for example, became the first state to abolish slavery entirely in its constitution of 1777. In the southern states, however, where slavery was more deeply entrenched and played a crucial role in the economy, the importation of slaves continued. States like South Carolina and Georgia actively participated in the slave trade, importing large numbers of African slaves to meet the labor demands of their plantations.

Overall, it is important to recognize that the relationship between the War of Independence and the slave trade was complex and varied across different states. While some states did increase their importation of slaves, it is not accurate to claim that nearly every state did so. The Revolutionary War and the ideas it promoted also contributed to a growing anti-slavery sentiment, leading to efforts to restrict or abolish the slave trade in certain regions.

To learn more about imports at brainly.com/question/31969652

#SPJ11

american economic prosperity in the 1920s was driven by the automobile industry. which of the statements describe the automobile industry in the 1920s?

Answers

The accompanying assertions portray the auto business during the 1920s are both, Automobile production, Large scale manufacturing, Quick Extension, Further developed Framework and Shopper Culture.

Quick Extension: The vehicle business experienced fast development during the 1920s, with creation and deals expanding fundamentally.

Large scale manufacturing: The presentation of sequential construction system creation strategies considered large scale manufacturing of vehicles, making them more reasonable for a more extensive scope of buyers.

Further developed Framework: The development of the vehicle business was joined by the advancement of new streets and expressways, making travel more straightforward and quicker.

Expansion in Shopper Spending: The expanded accessibility of cars prompted an expansion in buyer spending, adding to generally financial success.

Business Open doors: The development of the auto business set out new work open doors, especially in the assembling area.

Shopper Culture: The auto turned into an image of status and a foundation of purchaser culture during the 1920s, mirroring the monetary thriving of the time.

These assertions feature the significant pretended by the car business in driving American financial flourishing during the 1920s.

The car business during the 1920s drove American financial flourishing through quick extension, large scale manufacturing, further developed foundation, expanded customer spending, and new work open doors.

To learn more about american economic prosperity, refer:

https://brainly.com/question/30366174

#SPJ4

The complete question is:

American economic prosperity in the 1920's was driven by the automobile industry. Which of the statements describe the automobile industry in the 1920s?

a. Automobile production tripled during the 1920s.

b. The automobile industry stimulated the expansion of the oil, rubber, and steel industries.

What is a good quote on Social Responsibility/Civic Engagement that was stated by a historical figure between 1776 and 1877

Answers

Answer:  A quote by Thomas Jefferson in 1820:

"I know of no safe depository of the ultimate powers of the society but the people themselves; and if we think them not enlightened enough to exercise their control with a wholesome discretion, the remedy is not to take it from them, but inform their discretion."

Explanation:

This quote is about entrusting the American people with the "ultimate powers" by allowing them to vote and have a say in that destiny. If the people cannot exercise proper control, then Jefferson suggests that they should be reminded of that responsibility rather than taking it away (like other forms of government). This statement is the essence of democratic social responsibility.

In four presidential elections, most recently in 2000, the candidate who lost the popular vote nonetheless became President… Why is that possible?

Answers

Answer: Because the electoral college makes elections a winner takes all system. For example, by only getting 51% of the population to vote for you from smallest states to largest until you win 269 electoral votes, you can win an election by only having 21% of the pop. vote for you. Many politicians have been looking for alternatives for electoral college due to its controversy.

Explanation:

Identify and explain any THREE (3) differences between the Samurai culture and the

modernized culture that is being introduced at this time period.

Answers

Answer:

The Samurai culture and the modernized culture introduced during that time period are vastly different. Here are three key differences:

Social Structure: The Samurai culture was based on a rigid social structure, where each person's role was clearly defined. The Samurai were at the top of this hierarchy and were respected for their martial skills and honor code. The modernized culture, on the other hand, was more egalitarian, with less emphasis on social status and more on individual achievement.

Education: In Samurai culture, education focused on military training and developing martial skills, while modernized education focused on science, technology, and other academic subjects. Samurai education was often limited to the elite class, while modernized education was more widely available to the general population.

Values: The Samurai culture placed great emphasis on honor, loyalty, and duty, and Samurai were expected to follow a strict code of conduct. The modernized culture, on the other hand, placed more emphasis on individualism, progress, and material wealth. The Samurai were willing to die for their beliefs, while modernized culture placed a higher value on personal safety and self-preservation.

Overall, the Samurai culture was based on a traditional, hierarchical social structure, with a focus on martial training and honor. Modernized culture, on the other hand, emphasized individualism, progress, and academic education, and placed less emphasis on rigid social hierarchies and honor codes.

Which job belonged to the women of the Powhatan peoples?

Answers

They were as strong as men so probably something strong

why was there a debate between the federal and state governments over the funding of transportation improvements?

Answers

Because transportation movements were expensive

Fill in the blank
With the development of the first civilizations, many different people began serving in different roles and doing specific jobs and tasks. _____(Job Specialization,Animism,Surplus) means to focus on one activity, area of interest, or skill. Instead of everyone working on major tasks for survival, people in these civilizations were able to develop and perfect________(New Trades,Artifacts,Culture). Other than Hunting,______(Cultural Diffusion,Scribes,Farming) and _____(Banking,Metal Working,Carpentry)became important skills necessary for population growth. As cultures grew and merged, through trade, conquest and migration,_____(Cultural Diffusion, Steppes,Animism)occurred, spreading the new skills, ideas and information from one place to another.

Answers

With the development of the first civilizations, many different people began serving in different roles and doing specific jobs and tasks. Job Specialization means to focus on one activity, area of interest, or skill. Instead of everyone working on major tasks for survival, people in these civilizations were able to develop and perfect Culture. Other than Hunting, Farming and Carpentry became important skills necessary for population growth. As cultures grew and merged, through trade, conquest and migration, Animism occurred, spreading the new skills, ideas and information from one place to another.

Job specialization is a system that takes place when employees advantage expertise, training and revel in in a specific vicinity of expertise. The significance of task specialization in the contemporary-day team of workers is that it allows to fulfill the want for skilled workers.

because job specialization allows good sized expertise build-up in a selected task, the studying and speed of manufacturing happen faster. The activity does now not involve complicated processes, so it can study quicker to new employees.

A Job specialization is the listing of endorsed qualities for someone to qualify for and achieve a role. while the task description includes the name role, duties and precis, the specification identifies the capabilities, traits, education and experience a candidate would possibly need to qualify for that job.

Learn more about Job specialization here:- https://brainly.com/question/11276373

#SPJ1

what federal programs instituted in the 1930s and later discontinued mights be of use to the nation today?

Answers

Because they aided the economy by generating jobs through the constitution, the works progress administration.

What New Deal-era policy is still in place today?

Over time, their coalition grew weaker, but many of the New Deal initiatives that held them together—such as Social Security, unemployment benefits, and federal agricultural subsidies—remain in place today.

What impact did the 1930s New Deal policies have on Americans?

Short-term life improvements were made possible by New Deal programs for those affected by the depression's events. The federal government eventually came to play a significant role in the country's economic and social affairs as a result of New Deal policies.

To know more about federal  visit:-

https://brainly.com/question/8305583

#SPJ1

Where does the power to amend the Constitution come from? *

A. Article |
B. Article 11
C. Article III
D. Article IV

Answers

The authority to amend the Constitution of the United States is derived from Article V of the Constitution.

What do many of the every day colonists begin to do

Answers

Answer:

A colonist is a member of a government-backed group that settles in a new country or region. ... A colonist can also be called a settler, someone who helps start a settlement in a new land.

Explanation:

Egypt and Nubia relied on the Nile River because it:

A. was a major source of gold and silver.

B. connected them to Mesopotamia.

C. brought water to crops when jt, flooded.

D. was shallow enough to cross without boats.

Answers

Answer:C.Brought water to crops when jt, flodded

Explanation: It is C because back then they survived mostly from their crops and their were a lot of people to feed and more crops to water and grow. It was really helpful to live next to the Nile river because it watered their crops for them.

Answer:

C

Explanation:

(q005) southern senators and representatives threatened to leave the union over california's status as a free state. why? did this bring about national tension leading up to the civil war?

Answers

Southern senators and representatives threatened to leave the Union over California's status as a free state because it upset the delicate balance of power between free and slave states. This heightened sectional tensions and contributed to the lead-up to the Civil War.

The issue of California's status as a free state arose during the debates surrounding the Compromise of 1850, a series of laws aimed at resolving conflicts between free and slave states.

California's application for statehood as a free state threatened to upset the balance of power in Congress, where the number of free and slave states was roughly equal. Southern states were concerned that admitting California as a free state would give the free states an advantage in Congress, potentially leading to the passage of anti-slavery legislation.

Southern senators and representatives saw the admission of California as a free state as a threat to their interests and the institution of slavery. They believed that allowing California to enter the Union as a free state would set a precedent for future territories seeking statehood and potentially lead to the abolition of slavery altogether.

As a result, they issued threats to secede from the Union, effectively breaking away from the United States if their demands were not met.

These threats of secession intensified national tensions and exacerbated the growing divide between the North and the South. The Southern states felt increasingly marginalized and believed that their economic and social system was under attack.

This, combined with other contentious issues such as the enforcement of the Fugitive Slave Act and the debate over the expansion of slavery into new territories, further deepened the divide between the two regions.

In conclusion, the threat of Southern states to leave the Union over California's status as a free state was rooted in their fears of losing power and the potential erosion of the institution of slavery. This, along with other sectional conflicts, contributed to the mounting tensions that eventually led to the outbreak of the Civil War.

The Compromise of 1850 was a series of legislative measures that attempted to address the territorial and slavery disputes between the North and the South. It included provisions such as the admission of California as a free state, the strengthening of the Fugitive Slave Act, and the organization of the Utah and New Mexico territories.

The Compromise temporarily eased tensions, but it ultimately failed to resolve the underlying issues and was overshadowed by the subsequent conflicts that led to the Civil War.

Learn more about senators

brainly.com/question/29787372

#SPJ11

Merchants turned to bankers to help finance their ventures true or fale

Answers

Think that would be false

What kind of technological advancements were made during "The Space Race"?

Answers

Answer:

The Space Race, which took place during the Cold War era between the United States and the Soviet Union, led to several significant technological advancements. Here are some notable examples:

Satellites: Both the United States and the Soviet Union made significant strides in satellite technology. The Soviet Union launched the first artificial satellite, Sputnik 1, in 1957, followed by the United States launching Explorer 1 in 1958. These milestones paved the way for advancements in telecommunications, weather forecasting, and global positioning systems.

Human Spaceflight: The Space Race saw rapid progress in human spaceflight capabilities. In 1961, the Soviet Union achieved a major milestone by sending the first human, Yuri Gagarin, into space aboard Vostok 1. The United States responded with the Mercury program, which successfully sent astronauts into space. This eventually led to the Apollo program, which culminated in the moon landing in 1969.

Rocket Technology: Both countries made significant advancements in rocket technology during the Space Race. The Soviet Union developed powerful rockets such as the R-7, which launched the first satellite and carried the first human into space. The United States developed the Saturn V rocket, which was used for the Apollo missions and remains one of the most powerful rockets ever built.

Lunar Exploration: The Space Race spurred advancements in lunar exploration technology. The United States developed the Lunar Module (LM) as part of the Apollo program, which allowed astronauts to land on the moon's surface and then return to the Command Module. This achievement marked the first human exploration of another celestial body.

Spacecraft Design: The competition between the United States and the Soviet Union drove innovations in spacecraft design. Both countries developed and refined spacecraft to withstand the challenges of space travel, including radiation, extreme temperatures, and the absence of gravity. This led to advancements in materials, life support systems, and reentry technology.

Computing and Data Processing: The Space Race demanded advancements in computing and data processing capabilities. From trajectory calculations to monitoring systems, computers played a vital role in space missions. The development of miniaturized and more powerful computers became critical for navigation, communication, and data analysis in space exploration.

These technological advancements during the Space Race not only furthered human exploration of space but also had broader impacts on various fields, including telecommunications, materials science, computer technology, and aerospace engineering. They laid the foundation for future space missions and contributed to scientific knowledge and technological progress on Earth.

Explanation:

When Henry was sent to Richmond, what happened to his parents and siblings? What do you imagine this would have been like?

Answers

The correct answer to this open question is the following.

Although you did not include references, context, or further information to know who is Henry or the topic of your question, doing some research we can comment on the following.

We assume you are talking about the story of Henry "Box" Brown.

When Henry was sent to Richmond, his parents and siblings were sold and remained slaves in the plantations. Henry had been a slave too and when he was 15 years old he was sent to a tobacco factory in Richmond, Virginia.

I think this would have been heartbreaking for him and his family. They should have been felt devastated. That is why he always tried to be free, and after his wife and kids were sold to a landlord in the state of North Carolina, he decided to escape to Pennsylvania. He got himself into a box and was shipped to the port of Philadelphia.

In what ways did the relationship between the United States and the Soviet Union change during the second half of the Cold War?

Answers

Some of the ways the relationship between the United States and the Soviet Union change during the second half of the Cold War include:

DétenteIncreased competition in the Third World

How did the relationship between the superpowers change ?

In the 1970s, both the United States and the Soviet Union aimed to achieve détente - a process of easing tensions and enhancing relations between the two global superpowers.

Nevertheless, this did not prevent either side from competing for dominance in emerging nations. As a result, each country supported various countries and movements as they found themselves embroiled in military conflicts across Asia, Africa, and Eastern Europe. Some such places included Vietnam, Angola, and Afghanistan.

Find out more on the Soviet Union at https://brainly.com/question/27166979

#SPJ4

the cease-fire that ended the vietnam war stated that americans had to return communist prisoners of war. communists had to withdraw their forces from

Answers

The cease-fire that ended the Vietnam War stated that Americans had to return communist prisoners of war and communists had to withdraw their forces from the South of Vietnam.The Paris Peace Accords of 1973, also known as the Agreement on Ending the War and Restoring Peace in Vietnam, was a peace treaty signed on January 27, 1973. The purpose of the treaty was to put an end to the Vietnam War. The cease-fire was one of the main components of the treaty. The cease-fire agreement included the following provisions:Americans had to return communist prisoners of war.The communists had to withdraw their forces from the South of Vietnam.The North Vietnamese army was allowed to leave their troops in the South of Vietnam, while the United States was permitted to keep some of their troops in the region.The United States and other countries agreed to provide economic aid to help rebuild the country.The treaty was signed by the representatives of the United States, North Vietnam, South Vietnam, and the Viet Cong. Although the peace agreement was signed in 1973, it did not last very long. Within two years, the South of Vietnam was overrun by the North, and the country was united under a communist government.

For more question like Cease-fire visit the link below:

https://brainly.com/question/3281540

#SPJ11

Choose the word or phrase that best completes the following sentences. squanto assisted the colonists of which new england colony?

Answers

The answer is Squanto assisted the colonists of the Plymouth Colony in New England. Squanto's guidance and knowledge significantly aided Plymouth Colony's survival and Native American relations.

Squanto, also known as Tisquantum, played a crucial role in assisting the colonists of the Plymouth Colony in New England. Squanto was a member of the Patuxet tribe and had previous experience with English settlers.

When the Pilgrims arrived in Plymouth in 1620, they faced numerous challenges, including harsh weather conditions, unfamiliar land, and difficulties in establishing agricultural practices.

Squanto, who had learned English during his earlier encounters with European traders, became an invaluable mediator between the Pilgrims and the indigenous communities in the region.

Squanto taught the Pilgrims essential survival skills, such as cultivating corn, fishing, and establishing trade relationships with other Native American tribes.

He also acted as a translator and negotiator, facilitating peaceful interactions and alliances between the Pilgrims and the Wampanoag tribe, led by Chief Massasoit.

Squanto's assistance was instrumental in the survival and eventual success of the Plymouth Colony, as his knowledge and guidance helped the colonists adapt to their new environment and establish harmonious relations with the Native American communities in the area.

Learn more about Plymouth here:

https://brainly.com/question/28463915

#SPJ11

One political change during Reconstruction, One economic change during Reconstruction, One social change during Reconstruction

Answers

Answer:

answers on quizlet

Explanation:

Answer:

The Reconstruction era redefined U.S. citizenship and expanded the franchise, changed the relationship between the federal government and the governments of the states, and highlighted the differences between political and economic democracy.

Explanation:

The ________ in 1987 popularized the term sustainability. Kyoto Protocol Brundtland Report Paris COP21 Rio Climate Change Convention

Answers

The Brundtland Report in 1987 popularized the term sustainability.

The Kyoto Protocol was adopted on 11 December 1997. Owing to a complex ratification process, it entered into force on 16 February 2005. Currently, there are 192 Parties to the Kyoto Protocol.

In short, the Kyoto Protocol operationalizes the United Nations Framework Convention on Climate Change by committing industrialized countries and economies in transition to limit and reduce greenhouse gases (GHG) emissions in accordance with agreed individual targets. The Convention itself only asks those countries to adopt policies and measures on mitigation and to report periodically.

The Kyoto Protocol is based on the principles and provisions of the Convention and follows its annex-based structure. It only binds developed countries, and places a heavier burden on them under the principle of “common but differentiated responsibility and respective capabilities”, because it recognizes that they are largely responsible for the current high levels of GHG emissions in the atmosphere.

To know more about The Kyoto Protocol click this link-

brainly.in/question/35454778

#SPJ11

which statements about middle-class farmers in the antebellum south are correct? multiple select question. they had fewer social and educational opportunities than the middle-class professionals. they were just as exploitive as plantation owners in trying to amass fortunes in the slave economy. they owned massive plots of land and used a lot of enslaved labor to maintain it.

Answers

The correct statement middle-class farmers in the antebellum south they owned massive plots of land enslaved labor to maintain, other two statements are incorrect as middle-class farmers had more social and educational opportunities than lower-class farmers, some may have participated slave economy they not exploitive as plantation owners.

The best response from the list would be "Slave economy helped the  labour  grow because it was taxed," but that answer focused more on free labour than taxation.

On January 1, 1863, President Abraham Lincoln signed The Emancipation Proclamation into law. In eleven Confederate states that were in uprising against the Union, the executive order declared freedom for slaves.  Additionally, it permitted emancipated slaves to fight for the causes of national unification and the abolition of slavery by enlisting in the Union Army.  According to the Historical Society of Pennsylvania, "The Proclamation broadened the goals of the Union war effort; it made the eradication of slavery into an explicit Union goal, in addition to the reuniting of the country."

Learn more about Slave economy here

https://brainly.com/question/4040034

#SPJ11

how did slavery cause the civil war leq apush

Answers

The cause of the American Civil War was complex and multifaceted, and slavery played a significant role in its outbreak. Slavery had been a divisive issue in American politics since the founding of the country, and by the mid-19th century, tensions had reached a breaking point.

Here are some ways in which slavery contributed to the outbreak of the Civil War:

Economic and social differences: The North and South had become increasingly economically and socially different, with the North embracing industrialization and wage labor, while the South relied heavily on agriculture and the labor of enslaved people. These differences created a growing divide between the two regions, and led to political tensions over issues such as tariffs and states' rights.The expansion of slavery: As the United States expanded westward, there was growing tension over whether new territories would allow slavery or not. The South wanted to expand slavery into these new territories, while the North opposed it. This led to a series of political crises, including the Missouri Compromise, the Compromise of 1850, and the Kansas-Nebraska Act, which further heightened tensions between the two regions.The issue of slavery in the territories: The issue of slavery in the territories came to a head with the 1857 Supreme Court case Dred Scott v. Sandford. The Court's decision, which held that African Americans could not be citizens and that Congress had no power to regulate slavery in the territories, outraged many in the North and further increased tensions.The election of Abraham Lincoln: The 1860 presidential election, in which Abraham Lincoln was elected, was a turning point in the tensions between the North and South. Lincoln opposed the expansion of slavery and his election led many in the South to fear that he would seek to abolish slavery altogether. This fear, along with other political tensions, led to the secession of several Southern states and the formation of the Confederate States of America, ultimately leading to the outbreak of the Civil War.

While slavery was not the only cause of the Civil War, it played a significant role in the tensions and conflicts that led to its outbreak. The issues of slavery, states' rights, and the balance of power between the North and South were deeply interconnected and contributed to the deep divisions that ultimately led to the outbreak of the war.

To know more about American Civil war refer to-

brainly.com/question/28815289#

#SPJ11

Using Source 4, which statements reflect the implementation of the New Deal? Select three correct answers. A B C E The social programs proposed by FDR were largely blocked by Congress, so the New Deal barely addressed any of the economic needs. The New Deal was successful in easing some of the effects of the Great Depression, but it was criticized for providing too much and too little relief. FDR's position was similar to Hoover, so his New Deal legislation was limited in its impact on big issues like banking and unemployment. Despite the number of New Deal programs enacted, wartime spending and production ultimately ended the Great Depression. By explaining New Deal programs on the radio, FDR made people feel like the government cared about them personally. People did not understand what FDR was trying to do with the New Deal, and as a result, he was voted out of office after one term.​

Answers

Roosevelt's economic policies drew criticism, notably the shift from individualism to collectivism that occurred with the stratospheric expansion of the welfare state and the government's control over the market.

What did FDR desire with the New Deal?

Large drops were seen in both productivity and earnings and salaries. Franklin D. Roosevelt's New Deal (1933–1939) aimed to stabilize the economy while simultaneously providing short-term economic help. Learn more about this period of severe economic decline.

What was FDR's New Deal, and how did it change how the American government operated?

The New Deal introduced a wide range of federal government projects with the goals of boosting the economy, managing the private sector, and helping the underprivileged. The New Deal is typically summed up as the "Three Rs": (For the jobless) Relief (for the unemployed)

Option (b), The New Deal was effective in reducing some of the impacts of the Great Depression, but it was criticized for offering both too much and too little assistance.

Option (c), FDR held a viewpoint comparable to Hoover's, hence the influence of his New Deal legislation on significant subjects like banking and unemployment was constrained.

Option (f), Because the public could not comprehend what FDR was attempting to accomplish with the New Deal, he was removed from office after serving just one term.

Learn more about Franklin D. Roosevelt's New Deal: https://brainly.com/question/8273792

#SPJ1

The complete question is:

Using Source 4, which statements reflect the implementation of the New Deal? Select three correct answers.

The social programs proposed by FDR were largely blocked by Congress, so the New Deal barely addressed any of the economic needs. The New Deal was successful in easing some of the effects of the Great Depression, but it was criticized for providing too much and too little relief. FDR's position was similar to Hoover, so his New Deal legislation was limited in its impact on big issues like banking and unemployment. Despite the number of New Deal programs enacted, wartime spending and production ultimately ended the Great Depression. By explaining New Deal programs on the radio, FDR made people feel like the government cared about them personally. People did not understand what FDR was trying to do with the New Deal, and as a result, he was voted out of office after one term.​
Other Questions
What is the sad reality of the plantation complex? children quickly learn not to talk in elevators due to what principle? Which of the following nucleic acid complexes would undergo correction by the DNA mismatch repair system? UAGUCUUACAUUCCAUAUGG 3' (6%) Antisense 3' _ ATCAGAATGTAAGGTATACC-5' B. GTGCCCACGATTCAGTGGGC 3' (2%) Antisense 3' CACGGGTGCTAAGTCACCCG-5' GCGCCACGATTTAACGTGGC (62%) Anlisense 3' CGCGGTGCTAAGTTGCACCG-5' GGGCCCACGCUACGACGUUC 3' (28%) Anlisonse 3' CCCGAGTGCGATGCTGCAAG X Find the missing length in the trapezoid and explain how to get it 4) The business needs of XYZ, Inc is changing so the company will have to go through ________ to evolve its functionality.A) preventive maintenanceB) perfective maintenanceC) corrective maintenanceD) adaptive maintenance Which of the following is an example of how continental drift can determine the climate Andrew johnson did not believe in granting citizenship to all african americans. I could use some help on this Which of the following decision-making styles is characterized by the highest level of leader control?A. ConsultativeB. AutocraticC. DelegativeD. FacilitativeE. Supportive 4. Which side shot first on April 19th? 1775 Given: -2x < 10. Choose the solution set. {x | x > -5} {x | x > -20} {x | x < -5} {x | x < -20} Is this a function?{(2, 4), (2,5), (2,6), (2,7)} Switching from an omnivorous dietary pattern to a vegetarian dietary pattern would most likely ______ your intake of potassium. The earth's radius is 6.37106m; it rotates once every 24 hours. What is the earth's angular speed? Explain the impactful discovery for human race sofar. how does the ninth amendment protect individual rights? standard deviation of the data. 160,220,220,249,190 Joanie believes that you cannot use cross products to solve the proportion startfraction 50 over 3 endfraction = startfraction 75 over x endfraction for x. she says that if you multiply both sides of the equation by x, you get startfraction 50 x over 3 endfraction = 75. then, if you multiply both sides of the equation by 3, you get 50 x = 75, which is a different equation than you would get if you cross multiplied. what mistake did joanie make in her reasoning? she assumed that the multiplication property of equality allows her to multiply both sides of the equation startfraction 50 over 3 endfraction = startfraction 75 over x endfraction by x. she assumed that the multiplication property of equality allows her to multiply both sides of the equation startfraction 50 x over 3 endfraction = 75 by 3. she assumed that 50 x = 75 is the equation that you get if you multiply both sides of the equation startfraction 50 x over 3 endfraction = 75 by 3. she assumed that 50 x = 75 is a different equation than you would get if you cross multiplied to solve the proportion startfraction 50 over 3 endfraction = startfraction 75 over x endfraction for x. FILL IN THE BLANK. these fragments comprise much of what remains of a colossal marble-and-bronze statue of the roman emperor ________ seated on a throne. it was made in _________ ce to be placed in _________ in the center of ________ . Dissolution of 2D Molybdenum Disulfide Generates Differential Toxicity among Liver Cell Types Compared to Non-toxic 2D Boron Nitride Effects