What is a key difference between carbohydrates and proteins?

A. Carbohydrates are biomolecules; proteins are not
B. Proteins contain covalent bonds; carbohydrates do not
C. Proteins contain nitrogen; carbohydrates do not
D. Carbohydrates contain carbon; proteins do not

Answers

Answer 1

Answer:

C

Explanation:


Related Questions

what is the function of carbonhydrates in organisms

Answers

Answer: to supply energy to all cells in the body.

Explanation:

Look at the photosynthesis reaction.
6CO, + 6H,0- CoHO6 + 60,
What is produced as a result of photosynthesis?
O Glucose and oxygen
O Carbon dioxide and water
O Glucose and chlorophyll
O Water and light

Answers

Answer:

Glucose and oxygen

Explanation:

According to the reaction, photosynthesis is the process by which plants manufacture their food in the presence of sunlight to give off glucose and oxygen

Mammals can be distinguished from other tetrapods by the presence of:_______

Answers

Mammals can be distinguished from other tetrapods by the presence of hair or fur, mammary glands, and a three-bone middle ear. These features help explain their unique characteristics and adaptations in comparison to other tetrapod species.

An animal of the class Mammalia known as a mammal is a vertebrate. A neocortex portion of the brain, fur or hair, and three middle ear bones are features that distinguish mammals from other animals. Mammary glands that produce milk are present in mammals since they are used to nursing their young. With regard to these traits, they set themselves apart from birds and reptiles, from which their progenitors diverged during the Carboniferous Period more than 300 million years ago. Mammals have been classified into 29 orders and number 6,400 species in the wild.

To know more about Mammals click here:

https://brainly.com/question/30075321

#SPJ11

if the original dna sequence is 3' - gtt tac ctc tcc gac atc - 5' [template strand] 5' - caa atg gag agg ctg tag - 3' [coding/non-template strand] a point mutation occur and change the sequence to 3' - gtt tac atc tcc gac atc - 5' [template strand] 5' - caa atg tag agg ctg tag - 3' [coding/non-template strand] what type of mutation is this?

Answers

The given type of mutation is nonsense mutation which results from point mutation.

A nonsense mutation in a DNA sequence causes a premature stop codon, also known as a nonsense codon, in the transcribed mRNA as well as a shortened, ineffective, and typically nonfunctional protein product.

As was mentioned previously, a nonsense mutation happens when a stop codon replaces an amino acid's codon. A shortened and typically nonfunctional protein is the result of this mutation. By altering a tRNA molecule's anticodon sequence such that it recognizes the stop codon instead of the start codon, such a deficiency may be at least partially repressed.

Therefore, the given type of mutation is nonsense mutation which results from point mutation.

Learn more about nonsense mutation here:

https://brainly.com/question/15577866

#SPJ4

One popular attraction in Austin, Texas is a spring-fed swimming area called Barton Springs Pool. The pool is fed by the Barton Spring which is fed by the Edwards Aquifer. Since the 1980s, the pool is occasionally closed due to high bacteria levels. Which is the BEST explanation for the source of bacterial contamination?

Answers

The explanation for the source of bacterial contamination will be "a housing development with septic systems was built in the Barton Creek watershed."

What is bacteria?

Generally, Bacteria are germs that possess mono-cell structure and has them more in comparison to other organisms.

In conclusion, In the Barton Creek watershed, a housing complex with septic systems was created.

Read more about Disease

https://brainly.com/question/943439

In order to convert prairie grass to bioethanol, what is needed after breaking down cellulose to simple sugars?
A. fermentation
B. cellulase
C. amylase
D. protease

Answers

Answer:

fermentation

Explanation:

When you ferment there will be chemical break down of the substance

what was the role of revivalists of the second great awakening in the abolitionist movement? A. the revivalists of the second great awakening were against the abolitionist movement. B. many of the revivalists of the second great awakening campaigned against slavery. C. revivalists preachers didn't believe in slavery. D. most revivalists taught their enslaved people to preach to the American Indians.​

Answers

Answer:

Im pretty sure it b

Explanation:

The tutorial said so

Answer:

The answer would be b

Explanation:

Describe what happens to organisms that live in an environment with limited resources
PLS ANSWER FAST

Answers

They face limiting factors so they will either have to begin evolving to compensate for the limited resources or they will die out.

What’s the corresponding mRNA strand for this DNA strand: TACGGGATAAGGCCACCTCTGGTAGACCACATT

Answers

Thymine(T) pairs with adenine(A)

Adenine(A) pairs with uracil(U)

Cytosine(C) pairs with guanine(G)

therefore the corresponding mRNA strand for TACGGGATAAGGCCACCTCTGGTAGACCACATT

is

AUGCCCUAUUCCGGUGGAGACCAUCUGGUGUAA

Photosynthesis is a chemical reaction that occurs in the __________, an organelle found only in plant cells. The reactants of photosynthesis are __________, carbon dioxide, and water. The _________ of photosynthesis are glucose and oxygen

Answers

Answer:

The correct answer is - a) chloroplast 2) sunlight 3) products

Explanation:

Photosynthesis is the process that includes a set o chemical reaction that takes place inside the green plants and other photosynthetic organisms. These green plants or photosynthetic organisms have a special cell organelle known as chloroplast present in plant cells only that has a pigment called chlorophyll that is essential for photosynthesis.

Photosynthesis is a complex process but it can be understood as the reactants of this process that are sunlight, water, and carbon dioxide produces glucose and oxygen.

What occurs when there is a higher concentration of molecules on one side of a membrane and the molecules flow to the other side to balance the concentration
Fusion
ОООО
Simulus
Conversion

Answers

Answer:

Diffusion

Explanation:

The concept of diffusion states that molecules like to travel from areas of high concentration to low concentration.

Let's think about an example. Let's say you are having a party at your house and in one room there is 100 people and in the other room connected to it, there is only 10 people. What do you think is going to happen as time passes? Right, people are going to move to the room where there is less people so as to equally disperse themselves across the area. The same thing happens within our body with ions and gases.

Ions can diffuse into or out of cells based off their concentration gradients. If there are too many ions on one side, they will simply move to the other side. There are different types of diffusion. Passive diffusion and facilitated diffusion, but those are for a different conversation.

Classify each situation as a density dependent, inverse density dependent, or density independent mortality factor A forest fire kills 80% of the lodgepole pine trees found in a state park. As a heron population grows, competition for food and nesting sites survival A jaguar kills 4 antelope per week regardless of the size of the antelope herd. An unusual cold spell in April resutls in very high mortality for Florida manatees. Death rates from avian malaria decline as tropical bird species lose habitat.

Answers

Below is the Classification of each situation as a density dependent, inverse density dependent, or density independent mortality factor.

Density dependent - Competition for food and nesting grounds among more herons lowers the likelihood that their young will survive. As the habitat of tropical bird species is lost, avian malaria mortality rates decrease.

Inverse density dependent - No matter how many antelope there are in the herd, a jaguar only kills 4 of them each week.

Density independent - Eighty percent of the lodgepole pine trees in a state park perish in a forest fire. The mortality rate of Florida manatees is extremely high as a result of an unprecedented cold period in April.

Reasons:

Nesting and food competition are two density-dependent factors that have an impact on the first species' offsprings' ability to thrive.

For the second, the environment is a density-dependent component that changes as the number of tropical bird deaths from avian malaria declines.

A jaguar kills four antelope per week, regardless of the impact on the antelope population. Inverse density dependent. This component depends inversely on density.

Independent of density, a forest fire decimates 80% of the pine trees. The amount of trees or their density in the area has absolutely no bearing on how many trees per square mile perish in a forest fire. It is therefore a factor independent of density.

To learn more about density, refer:

https://brainly.com/question/17990467

#SPJ4

any help would be very much appreciated!

any help would be very much appreciated!

Answers

The pictures are shown for pathogens which are harmful to human body and 1st is virus 2nd is fungus 3rd is protozoa and 4th is bacteria.

Explanation: There are many pathogens that are harmful to people and they are harmful because they use the host machinery to replicate themselves and grow and also damages the host machinery and lyse the cell which in turn reduces the immunity of the host body and also make the host body prone to diseases leading to the early death of host or miserable life.

These pathogens are bacteria, protozoa, fungi, and viruses.

Virus - The viruses are considered as non-living or living depending upon whether they are outside the host cell or inside it as it they are outside they are nonliving and if inside they are living and have genetic material RNA or DNA and a protein coat called capsid.

Bacteria - The bacteria are also unicellular organisms which are prokaryotes and have a cell wall made up of peptidoglycan and can be divided in gram negative and gram-positive bacteria for example Xanthomonas.

Fungi - The fungi are multicellular organisms and have mycelia which is a thread-like structure in the form of a network called hyphae and they produce a different types of spores for their development.

Protozoa - They are microscopic and unicellular organisms and are eukaryotic in nature having complex structure and have complex metabolism and also have cilia for their movements.

So according to this 1st is virus 2nd is fungus 3rd is protozoa and 4th is bacteria.

To know more about this click at https://brainly.com/question/18456055

#SPJ4

2. In order to calculate momentum we must have the object's (2 points)
mass and velocity
speed and velocity
acceleration and mass
speed and acceleration

Answers

Answer:

Mass and velocity

Explanation:

Momentum is defined as the quantity of motion of a moving body measured as a product of it's mass and velocity. Have a nice day! ;-)

how has the radioactive fallout from the Chernobyl accident worked its way through the food web?​

Answers

The radioactive  from the Chernobyl worked its way through the food web as it affects the animals and plants that are main components of food web.

What is food web?

Food web is defined as naturally occuring interconnection of several food chains and it is the representation of which animal consume to whom to balance an community which is related to ecology. There are many benefits of food web and first of all member present on upper trophic level serves several small animals.

Plants are known as autotrophs because they prepare there own food in the presence of sunlight and the process is known as photosynthesis. In food web plants are known as producer because they produce food for other animal. In food web animals and other organisms are said to be consumer because they consume plants for their survival.

Therefore, the radioactive  from the Chernobyl worked its way through the food web as it affects the animals and plants that are main components of food web.

Learn more about food web here:

https://brainly.com/question/2233704

#SPJ2

Which is an example of respiration

Answers

Answer:

breathing is a example of respiration

What does it mean to code health?.

Answers

Code health mean a cardiac arrest.

cardiac arrest is typically meant when a patient is said to have "coded." Such a situation calls for immediate life-saving action. This is a possibility both within and outside of medical facilities. There are protocols and procedures in place to deal with this life-threatening issue as a result of the incident occurring in a professional healthcare setting. The perspective of responding to a code from an ER nurse is presented in what follows.

Each code differs from the next, just like every patient does. The characteristics of the patient in issue, including their comorbidities and history of current illness, are what determine the causes and effects of each code. In the New York suburbs, Timothy Wrede, RN, has worked as an emergency and critical care nurse for many years.

Learn more about  cardiac arrest here:

https://brainly.com/question/8920741

#SPJ4

how does pollution travel from a river to the ocean?

a) pollution flows upstream toward the ocean

b) pollution flows downstream toward the ocean

c) pollution flows toward the bank of a river and then to the ocean

d) pollution flows toward the source of a river

how does pollution travel from a river to the ocean?a) pollution flows upstream toward the ocean b) pollution

Answers

Answer:

d

Explanation:

I would say d, because the other guy said d

what's a good way to study for a test?

Answers

Answer:

Explanation:

.......Organize your study space.

...Use flow charts and diagrams. ...Practice on old exams.

...Explain your answers to others. ...Organize study groups with friends. ...Take regular breaks.

...Snack on brain food.

..Plan your exam day.

★彡 вч вєzα5 彡★

Why is graphing important to
scientists? (Give at least 2 reasons)

Answers

Answer:

They can help visualize the data.

You can actually see what all of the numbers in a data table mean.

Explanation:

Its hard to look at a set of data and understand what it means without organizing it in a way which is easy to understand and refer back to.

PLS HELP ASAP I SUCK AT THIS PLSS

PLS HELP ASAP I SUCK AT THIS PLSS

Answers

Answer:

Some limitations of modeling the flow of energy and matter in an ecosystem with a food chain can be if you took a bear out of its habitat and moved it to the desert the food chain would be very messed up. Reason for that is animals eat bears and bears it animals. So if the bear doesn't eat the animals they might overpopulate.

Explanation:

Have a great day

1. What is a DFA configuration? Give me an example.

2. what is the difference between a NFA and a DFA?

Answers

Answer:

1)

In the context of automata theory, a DFA (Deterministic Finite Automaton) configuration refers to the state of the DFA along with the current input symbol being processed. It represents the instantaneous snapshot of the DFA during its computation.

A DFA configuration consists of two components:

Current State: It represents the state in which the DFA is currently located. In a DFA, the state is an essential part of its definition and determines the behaviour of the automaton.

Remaining Input: It represents the portion of the input yet to be processed by the DFA. As the DFA reads input symbols one by one, the remaining input is reduced until it is completely consumed.

Let's consider a simple example of a DFA that recognizes the language of all binary strings ending with '01'. The DFA has two states: State A and State B. Here's an example of a DFA configuration:

Current State: State B

Remaining Input: 1101

In this example, the DFA is in State B, and the remaining input is '1101'. It indicates that the DFA has already read the input '11' and is currently processing the symbol '0'. Based on the transition rules of the DFA, it will move to another state or remain in the same state, depending on the current state and input symbol.

2)

A DFA (Deterministic Finite Automaton) and an NFA (Nondeterministic Finite Automaton) are both types of finite automata used in automata theory. The main difference between them lies in their behaviour and the nature of transitions between states.

Determinism vs. Nondeterminism:

DFA: A DFA is deterministic, meaning that for any given state and input symbol, there is a unique transition to the next state. It follows a single, well-defined path for each input symbol.

NFA: An NFA is nondeterministic, meaning that for a given state and input symbol, there can be multiple possible transitions leading to different states. It can have several possible paths for each input symbol.

Transition Function:

DFA: In a DFA, the transition function is defined as a mapping from each state and input symbol to a unique next state. It is a total function, ensuring that every state and input symbol has a defined transition.

NFA: In an NFA, the transition function is defined as a mapping from each state and input symbol to a set of possible next states. It allows multiple transitions from the same state with the same input symbol or even transitions with the empty string (ε).

Acceptance of Input:

DFA: In a DFA, acceptance of an input string occurs if, after reading the entire input, the DFA is in an accepting state (a designated final state). If the DFA ends in a non-accepting state, the input is rejected.

NFA: In an NFA, acceptance of an input string can be more flexible. It can accept an input string if there exists at least one possible path through the NFA that leads to an accepting state. It is not necessary for all possible paths to lead to an accepting state.

Memory:

DFA: A DFA has no memory of the input it has previously read. It only considers the current input symbol and the current state to determine the next state.

NFA: An NFA can have memory by using ε-transitions, which allow it to transition to a new state without consuming any input symbol. It can make decisions based on its current state and the remaining input without reading additional input symbols.

Overall, DFAs are simpler and easier to analyze due to their deterministic nature, while NFAs offer more expressive power with their nondeterministic behaviour and ε-transitions. However, it's important to note that both DFA and NFA are equivalent in terms of the languages they can recognize, meaning that for any language recognized by an NFA, there exists an equivalent DFA and vice versa.

hey, hope you found this helpful hope you have a great rest of the day!

Which energy transformation occurs when the archer releases the string?
OA. Elastic energy is transformed into electrical energy.
OB. Chemical energy is transformed into elastic energy.
OC. Elastic energy is transformed into kinetic energy.
D. Potential energy is transformed into elastic energy.

Which energy transformation occurs when the archer releases the string?OA. Elastic energy is transformed

Answers

Answer:

OA. Elastic energy is transformed into electrical energy.

Explanation:

pls hart and mark brainiest

both compost and chemical fertilizer can be used for the balanced growth of plants.Do you agree?​

Answers

Answer: Yes I do.

Explanation:

Chemical fertilizers provide the plant with the major nutrients they need which are Nitrogen, Potassium and Phosphorus and they do so in abundant quantity such that the plant is able to utilize them and grow faster.

Organic fertilizer also provides those same nutrients but does so at a slower rate. It will however add other things to the soil such as beneficial microorganisms, and microbes which will work overtime to improve soil fertility.

In building soil fertility, the plant will have more nutrients as it grows.

Using both is therefore balanced with one providing nutrients early and the other ensuring that nutrients will be continually available for the plant.

What step would likely be affected if the bacteria are exposed to this antibiotic

Answers

Answer:

bacteria subjected to an antibiotics will have their ribosomes inhibited whixh will stop them from synthezing proteins which stops the possibility of reproduction and many other vital functions.

why is the energy reduced at each level of the energy pyramid

Answers

Answer: because every time something eats something 10% of the energy is passed on so it starts as 100% with plants photosynthesizing then the herbivore gets 10% of that energy. The carnivore that eats the herbivore gets 10% of the herbivore’s energy so by the time it gets to the top of the pyramid there is less and less energy to consume.

in contrast to glands which secrete their products outside the body, glands of the system secrete hormones in the extracellular fluid from where they diffuse into the surrounding blood capillaries

Answers

In contrast to exocrine glands which secrete their products outside the body, glands of the endocrine system secrete hormones in the extracellular fluid from where they diffuse into the surrounding blood capillaries.

The endocrine system is a network of glands that secrete hormones into the bloodstream to regulate various bodily functions such as growth and development, metabolism, and reproductive processes. Hormones are chemical messengers that are produced in one part of the body and travel through the bloodstream to target cells in other parts of the body.

Unlike exocrine glands, which secrete their products through ducts to the outside of the body or onto surfaces, endocrine glands secrete hormones directly into the bloodstream, allowing them to reach their target cells quickly and efficiently.

To learn more about exocrine follow the link:

https://brainly.com/question/29428903

#SPJ4

The complete question is:

Fill in the blanks:

In contrast to ________ glands which secrete their products outside the body, glands of the__________ system secrete hormones in the extracellular fluid from where they diffuse into the surrounding blood capillaries.

What best describes region B in the pictured phospholipid bilayer?
Choose 1 answer:
A.Nonpolar
B.Hydrophobic
C.Hydrophilic
D.Amphipathic

What best describes region B in the pictured phospholipid bilayer?Choose 1 answer:A.NonpolarB.HydrophobicC.HydrophilicD.Amphipathic

Answers

Answer:

The phosphate group is the negatively-charged polar head, which is hydrophilic. The fatty acid chains are the uncharged, nonpolar tails, which are hydrophobic. Since the tails are hydrophobic, they face the inside, away from the water and meet in the inner region of the membrane.

Explanation:

The word hydrophilic best describes region B in the pictured phospholipid bilayer. Thus, the correct option is C.

What is a Phospholipid bilayer?

A phospholipid bilayer may be defined as the arrangement of phosphates and lipid molecules in a form of two-layer to construct a cell membrane.

The region B in the picture is a hydrophilic molecule with a polar head. These are negatively charged phosphates groups that are always found at the exterior of the lipid bilayer.

Therefore, the correct option is C.

To learn more about Phospholipid bilayer, refer to the link:

https://brainly.com/question/15446044

#SPJ2

What would happen to the plant population if the caterpillar population decreased?

Answers

It would increase because it has 1 less thing that eats it

Answer:

it was increase

Explanation:

Of all six technologies that wood identifies, which do you find the most interesting, useful, or pertinent to your own life? discuss.

Answers

orbital launch vehicles are the most interesting, useful, or pertinent to your own life.

What is a launch vehicle?

A launch vehicle or carrier rocket may be a rocket-propelled vehicle used to carry a payload from Earth's surface to space, usually to Earth's orbit or beyond. A launch system includes the launch vehicle, launch pad, vehicle assembly, fueling systems, range safety, and other related infrastructure. Orbital launch vehicles are often grouped based on many different factors, most notably payload mass, although price points are a serious concern for some users.

To know more about orbital launch vehicles go to the given link:

https://brainly.com/question/6678709

#SPJ4

Other Questions
In which colonies was fishing important? A. Middle Colonies B. New England Colonies C. Southern Colonies John Harrington, Jr. ("Junior") is a 24-year-old, 3-pack-per-day smoker. John Harrington, Sr. ("Senior") is a very concerned parent. On January 1, father announces to son, "Junior, if you will stop smoking for the entire year, I will pay you $5,000." Senior believes that if Junior will stop smoking for one year, he will "kick the habit." Junior reluctantly accepts his fathers terms, and extinguishes his half-smoked cigarette with the heel of his boot.On January 1 of the following year, Junior approaches Senior and says "Dad, time to pay up." Senior has no reason to doubt that Junior has refrained from smoking for an entire year, but states "Son, this was for your benefit. The gift I have given you is the gift of life, and you are now likely to enjoy that gift longer, because you are now much less likely to contract cancer. Health statistics show that non-smokers live ten years longer than smokers. Enjoy your newfound life, but I will not pay you the $5,000."Does Senior owe Junior the $5,000? Is there an enforceable contract between father and son? If there is not an enforceable contract, does Junior have any other legal or equitable theory of recovery? Is Senior ethically obligated to pay Junior the $5,000? you have just concluded an employment interview with an applicant you like, who is qualified for the inside sales job you have been interviewing for, and have made a conditional offer of employment. you tell the applicant that you want her to take a medical exam, and if she passes, she has the job. she is at first obviously happy and seemingly relieved, but then breaks down in tears. she tells you that a medical will show that she is hiv positive. what should you do? Read the sentence.The ball that I bounced across the gymnasium floor eventually came to rest behind the bleachers.What best describes the purpose of the underlined clause in the sentence? A student compares the boiliing point of a substance having different intermolecular forces. which dependent variable did the student most likely use? Ancient American artists working in the Southwestern region of North America (Arizona, New Mexico, Colorado, and Utah) used ________ as an important building material. g Recently your lead carer has asked you for a written report about a resident whom you were taking care of. Focus on one of your daily cases, mentioning how this resident's records should be presented, stored and shared keeping in mind total confidentiality. suppose on september 1, tom sends joe an email with pdf attachments offering to buy his ranch for $125,000. and suppose that the offer says he must respond by september 5th. on september 2nd, joe sends written agreement to the offer by us mail. tom receives the acceptance in his office on september 10. is there a valid contract? I need help filling this out The space shuttle Endeavor is taking off vertically at a distance of 500m from an observer. If, when the angle of elevation is radians, it is changing at a rate of 0.5 rad/sec, a. How fast is the shuttle ascending? b. A TV camera is situated 100m from the site of the Endeavor launch. The rocket's elevation t seconds after liftoff is s=250t? How rapidly must the camera angle be increased in order to maintain a view of the rocket 4 seconds after liftoff? Joseph conducts a survey on which ice cream flavor the students at his school like best. his school has grades kindergarten to fifth grade. he surveys 30 of the 300 students for his sample. which group of 30 students would be the best sample survey? The following are weights in pounds of a college sports team: 165, 171, 174, 180, 182, 188, 189, 192, 198, 202, 202, 225, 228, 235, 240 a. The mean is: _________________ b. The sample standard deviation is: _______________ c. The first quartile is: _____________ d. The median is: ______________ e. The third quartile is: ______________ Which quantity is held constant when working with boyles, charless, and gay-lussacs laws? volume moles pressure temperature [Source:www.mars.nas Recall the TWO layers that the Earth's core can be divided into. (2x1) You can click the ________ button on the table toolbar to sort records in alphabetical order, from A to Z. what angle of incidence is going to get you the most light being transmitted into the water of the pool? Use an identity to solve the equation on the interval [0,2pi)sin^2 - 5 cos x + 5 = 0 A bank loaned out $14,500, part of ityat the rate of 6% annual interest, and the rest at 12% annual interest. the total interest earned for both loans was $1,020.00. how much was loaned at each rate? $ was loaned at 6% and ta was loaned at 12%. ta $ An auto manufacturer wants to estimate the annual income of owners of a particular model of automobile. A random sample of 200 current owners is selected. The population standard deviation is known. Which Excel function would NOT be appropriate to use to construct a confidence interval estimate Given u = and v = find 2u-3v.