What happened to the mass of the ice after it melted? Why did this thing happen? Compare the results of this experiment with your earlier prediction.

Answers

Answer 1

When ice melts, its mass remains the same. This is because melting is a physical change, not a chemical change.

The mass of a substance is the measure of the amount of matter it contains, and matter cannot be created or destroyed, only transformed from one form to another.

In this case, the ice transformed from a solid to a liquid, but the total amount of matter (i.e., the mass) remained the same. Therefore, the mass of the ice did not change after it melted.

This result is consistent with the prediction made earlier, which stated that the mass of the ice would remain the same after it melted.

To know more about chemical change click here:

https://brainly.com/question/23693316

#SPJ11


Related Questions


The phases of the Cell Cycle starting at the beginning of Interphase is
.
The beginning of the Cell Cycle Interphase____
. The next phase in Interphase is____
. The next phase in Interphase is____
.
. The second phase of mitosis is____
The next phase is the beginning of mitosis___
. The third phase of mitosis is___
.
.
The fourth and last phase of mitosis is____
After mitosis, the cell duplicates its cytoplasm in_____

Answers

Interphase is composed of G1 phase (cell growth), followed by S phase (DNA synthesis), followed by G2 phase (cell growth). At the end of interphase comes the mitotic phase, which is made up of mitosis and cytokinesis and leads to the formation of two daughter cells.

In a survey of a 46m² area, you count a total of 42 dandelions in 6 quadrats.
The quadrats have sides of 0.3m.
Determine the area covered by the quadrants.
Give your answer to 2 decimal places.

Answers

For each quadrant in the survey, area covered is 0.54m².

How are land surveys done?

Land surveys are performed to determine the precise location and boundaries of a piece of land. This is usually done for purposes such as property disputes, land development, and building construction. These are done through research, fieldwork, mapping etc.

To complete the survey, surveyors use specialized equipment such as GPSs, prisms, software, radios, and robotic total stations.

The area covered by each quadrat is 0.3m x 0.3m = 0.09m².

So the total area covered by the 6 quadrants is 0.09m² x 6 = 0.54m².

Learn more on land survey here: https://brainly.com/question/17373064

#SPJ1

The two populations are similar, but one is slightly more of a specialist in its diet, whereas the other is more of a generalist. Which population is more of a specialist? O Population B O Population A Read each of the following passages. After each passage, choose the term that most appropriately completes the sentence.

Answers

The population that is slightly more of a specialist in its diet would be Population A.

In ecology, a specialist is an organism that has a narrow diet and can only thrive under specific conditions, while a generalist can survive on a wide variety of food sources and environmental conditions.

The passage suggests that both populations have similar characteristics but one is "slightly more of a specialist in its diet." Therefore, Population A must have a narrower and more specific diet than Population B, making it the specialist population.

It's important to note that the passage does not provide explicit information on the diets of either population, nor does it define what "slightly more of a specialist" means in terms of the percentage of the diet that is specialized.

However, based on the given information, we can infer that Population A is more specialized than Population B, albeit only slightly.

To know more about ecology click on below link:

https://brainly.com/question/18562569#

#SPJ11

Complete question:

The two populations are similar, but one is slightly more of a specialist in its diet, whereas the other is more of a generalist. Which population is more of a specialist?  Answer the result from graph shown below

O Population B

O Population A

The two populations are similar, but one is slightly more of a specialist in its diet, whereas the other

Which series lists the hierarchy of life from largest to smallest?
A.molecule, tissue, cell, organ
B.molecule, cell, tissue, organ system
C.tissue, organ system, molecule, cell
D.organism, organ system, organ, tissue

Answers

Answer:

D

Explanation:

largest to smallest

D. Largest to smallest
B. Smallest to largest

The removal of the predator populations from an ecosystem would most likely result in?
O a decrease in all the prey populations
O an increase in all the producer populations
O an increase in ecosystem biodiversity
O a decrease in ecosystem biodiversity

Answers

Answer:

A decrease in all the prey populations.

Answer:

a decrease in all the prey populations

Explanation:

I Watched a video thing

Question 1 of 10
What is a major drawback of using fossil fuels?
A. They release carbon dioxide.
B. They destroy greenhouse gases.
O c. They generate electricity.
O D. They cool the planet.

Answers

Answer:

A.) They release carbon dioxide!! Why? Carbon dioxide is a greenhouse gas, and a lot of it is released by burning fossil fuels. This warms the planet and triggers climate change. I just did this a p e x biology quiz, so I would know. I got it correct :D.

how many lobes does the right lung have

Answers

The lungs are a pair of organs located in the thoracic cavity of the body and are responsible for the exchange of gases between the body and the environment. The lungs are divided into several lobes, with the right lung having three lobes and the left lung having two lobes.

The right lung is divided into the superior lobe, the middle lobe, and the inferior lobe. The superior lobe is the largest of the three lobes and is located at the top of the right lung. The middle lobe is located in the middle of the right lung, and the inferior lobe is located at the bottom of the right lung.

The reason why the right lung has three lobes while the left lung has two lobes is that the heart is located on the left side of the body, which takes up more space in the left thoracic cavity. Therefore, the left lung has to be smaller and have fewer lobes to accommodate the heart.

Additionally, the right lung is divided into three lobes because the right main bronchus, which is the main air passage that carries air to the lungs, divides into three branches. The first branch goes to the superior lobe, the second branch goes to the middle lobe, and the third branch goes to the inferior lobe.

In summary, the right lung is divided into three lobes, namely the superior lobe, the middle lobe, and the inferior lobe. This is because the heart is located on the left side of the body and takes up more space in the left thoracic cavity and also the right main bronchus divides into three branches which goes to the lobes of right lung.

Here you can learn more about right lung

https://brainly.com/question/18932342#

#SPJ11

In a species of bird, the allele for the striped trait is recessive to the allele for the speckled trait. Suppose that a coastal bird population has a striped phenotype frequency of and an inland population has a striped phenotype frequency of The two populations are isolated and in Hardy–Weinberg equilibrium. Let represent the allele frequency of the coastal population and represent the allele frequency of the inland population. Calculate the allele frequency for the striped allele for each population. Round your answers to the nearest hundredth.

Answers

Answer:

The answer is "0.42"

Explanation:

Please find the complete question in the attached file.

Coastal community striped allele intensity \(= q = 0.62\)

Landlocked community, strip intensity allele\(=q'=0.40\)

Its eliminated allele frequency for movement \(= q"=0.42 \ in \ indoors\)community And now in the sturdy vineyard optimum communities, genotype frequency of stripped characteristic (heterozygous device) in coasts\(=q_2=0.39\)

Heritable (striped) allele frecency:

\(\to q=\sqrt{q_2}\)

      \(=\sqrt{0.39} \\\\ =0.624 \\\\ =0.62\)

(round up to the closest cent) is therefore the only frequency of coastal people.

The genome of pulling function in host population\(= q'_2=0.16\) Heterozygous feature regularly.

Therefore the inland community rate of recessed (striped), allele rate:

\(\to q'= \sqrt{q'_{2}}= \sqrt{0.16}=0.40\)

Following migration;

Its percentage of coastal migrants:

\(m=10\% \\\\\)

   \(= \frac{10}{100} \\\\= 0.1\)

Coastal population Non-immigrant percentage of coastal residents:

\(=1- m\\\\=1-0.1\\\\ =0.9\)

Stripping coastal community of allele rate after immigration:

\((q")=\text{(stripping of migrant only freq)}\times (m)+\text{(stripping allele baud rate for non-immigrants)} \times ( 1-m)\)

       \(= [q \times m]+[[q' \times(1-m)]\\\\=(0.62 \times 0.1)+(0.40 \times 0.9)\\\\=0.062+ 0.36\\\\=0.422\\\\=0.42\)

In a species of bird, the allele for the striped trait is recessive to the allele for the speckled trait.

which bone cells are responsible for bone resorption? osteocytes osteocytes osteogenic cells osteogenic cells osteoclasts osteoclasts osteoblasts

Answers

Osteoclasts are involved in bone resorption and contribute to bone remodeling in response to bone growth and changes in mechanical loads on the skeleton. Osteoclasts are also involved in the long-term maintenance of blood calcium homeostasis

Osteoclasts are large, multinucleated phagocytes located within or adjacent to depressions or depressions on the bone surface called resorption pits that are involved in degradation in a key process called bone resorption. Osteoclasts remove bone by dissolving minerals and breaking down matrix in a process called bone resorption. Osteoclasts are the derived from the same of the progenitor cells in the bone marrow that produce white blood cells. Osteoclasts are specialized multinucleated giant cells that resorb bone. This is primarily done by remodeling of the extracellular matrix. Osteoclasts are derived from monocyte fusion and have approximately 2-12 nuclei per cell.

To know more about Osteoclasts  visit:

https://brainly.com/question/15503482?referrer=searchResults

#SPJ4

Carbohydrates lipids proteins and nucleic acids are important molecules in living organisms. These large structures have similarities, however they have certain differences that may be used to distinguish them.

Which of the following statement best describes the macromolecules ?

A) Oxygen and phosphate are found in carbon hydrates

B) Nitrogen atoms are found in proteins and lipids

C) Nitrogen and an R-group are present in proteins and nucleic acids

D) Hydrogen , carbon and oxygen atoms are present ​​

Answers

D) Hydrogen , carbon and oxygen atoms are present ​​

The statement that best describes the macromolecules is Hydrogen , carbon and oxygen atoms are present. Thus, option D is correct.

What is Carbohydrates?

Carbohydrates is defied as that contains biomolecule that contains carbon hydrogen and oxygen in a ratio of 2:1. Carbohydrates are mane source of energy of the body they work as fuel for the brain, kidneys central nervous system and heart muscle.

\(Cn(H2O)n\) is the basic formula for all carbohydrates . But this formula have limitation i.e it applies where same amount of carbon and water are use. Initially the terms carbohydrate was used to describe compounds that have really contains carbohydrates. Because they had simple formula \(CH20.\)

In modern Era carbohydrates are classified on the basis of their structure not on their formulae. Such as aldehydes and ketones are now known as polyhydroxy. Carbohydrates provides glucose to the body and, thereby, long lasting energy.

Therefore,The statement that best describes the macromolecules is Hydrogen , carbon and oxygen atoms are present. Thus, option D is correct.

Learn more about carbohydrate here:

https://brainly.com/question/14614055

#SPJ2

A pair of what chromosomes are the same size and contain the same genes in both males and females?.

Answers

The pair of chromosomes that are the same size and contain the same genes in both males and females are called homologous chromosomes.

Homologous chromosomes are the term that describes two chromosomes in pairs; one is inherited from the mother while the other one is inherited from the father. Both chromosomes have the same length, staining pattern, and centromere positions.

In humans, the homologous chromosomes come are carried in the haploid gamete cells, which are the sperm (from the father) and the egg (from the mother). When both gamete cells meet, fertilization occurs and starts to form a diploid organism.

Learn more about chromosomes at https://brainly.com/question/11912112

#SPJ4

katie, a powerful defender on her college soccer team, went to head a ball at the same time as her opponent. the two girls collided and struck their heads rather than the ball. katie, stunned, fell to the ground. the athletic trainer promptly evaluates katie for a concussion. one of the tests requires katie to follow the trainer's finger with her eyes only, as he moves it up and down and to the left and right. this test assesses three cranial nerves. what are those nerves?

Answers

The three cranial nerves that are assessed during the eye movement test are: Cranial Nerve III, Cranial Nerve IV, Cranial Nerve VI.

Cranial Nerve III (Oculomotor Nerve): This nerve controls the movement of the eye, including raising and lowering the eyelid and controlling the size of the pupil.

Cranial Nerve IV (Trochlear Nerve): This nerve controls the movement of the eye downward and inward.

Cranial Nerve VI (Abducens Nerve): This nerve controls the movement of the eye outward.

These three nerves are responsible for eye movement and are important in maintaining normal eye function.

To learn more about eye function visit:

brainly.com/question/17146693

#SPJ11

Which of the following explanation is FALSE about " antibodies"? a. IgG is found in tissues and serum, it enhances opsonisation by coating the organisms, it can cross placenta and it has four subclasses b. IgA crosses placenta and binds to the complement for opsonisation. c. IgM is the largest immunglobulin, it fixes the complement. d. IgD is found on the surface of B lymphocytes. e. IgE mediates the release of histamines.

Answers

The false statement about antibodies is: b. IgA crosses placenta and binds to the complement for opsonisation.

Antibodies are Y-shaped proteins that are produced and secreted by plasma cells (which are specialized B cells that have been activated to create antibodies) to fight infection. Antibodies have two heavy chains and two light chains, and the sequence of amino acids in the variable region of the chains determines the binding specificity of the antibody.

IgA is primarily found in mucus secretions, such as those in the respiratory and gastrointestinal tracts, as well as in breast milk and colostrum. It can help in preventing infections caused by invading pathogens by immobilizing and preventing them from adhering to mucosal surfaces.

Opsonization is a process by which bacteria and other pathogens are marked for destruction by a cell of the immune system called a phagocyte. Opsonins are molecules that bind to the surface of pathogens and make them more easily identifiable by phagocytes such as macrophages and neutrophils.

To know more about Antibodies visit:

https://brainly.com/question/27931383

#SPJ11

what are the two types of pressure?​

Answers

Hydrostatic pressure and osmotic pressure !

Answer these questions in one sentence. a. What life processes can a single cell carry out?​

Answers

Answer:

A single cell can carry out essential life processes such as metabolism, reproduction, growth, and homeostasis.

Explanation:

Metabolism refers to the chemical reactions that occur within a cell to obtain energy and carry out various biochemical processes. This includes processes like cellular respiration and the synthesis of molecules.

Reproduction refers to the ability of a cell to reproduce and create new cells, either through processes like binary fission in bacteria or mitosis in eukaryotic cells.

Growth refers to the increase in size or mass of a cell through the uptake of nutrients and the synthesis of macromolecules.

Homeostasis refers to the ability of a cell to maintain a stable internal environment by regulating parameters such as temperature, pH levels, and ion concentrations. This ensures that the cell functions optimally and can carry out its necessary processes.

2. What is plate tectonics?
a. The joining of the Earth’s plates into one plate
b. Movement of the Earth’s plates on the mantle
c. The ring of volcanoes around the Pacific Ocean
d. The way scientists measure earthquakes

Answers

Answer:

Suppose we add up alternate Fibonacci numbers, Fn-1 + Fn+1; that is, what do ... L(1)=1 and L(3)= 4 so their sum is 5 whereas F(2)=1; L(2)=3 and L(4)= 7 so their ... What is the relationship between F(n-2), and F(n+2)? You should be able to find a ... Fib(N); K (an EVEN number!), Lucas(K) and Fib(K) in each expression like ...

Explanation:

Someone please help me... I’m struggling right now and I feel like having a mental breakdown because of this. The second one is the picture for the second question. Please just do the second question and not the 3 and 4 someone pls help .

Someone please help me... Im struggling right now and I feel like having a mental breakdown because of

Answers

I will answer all of it for you.
A bridge may be defined as a structure built over a river, a dry valley, low land or an estuary or any depressed part of the land to provide a link between the two opposite sides. It is essentially a communication link on a road or railway track or a highway. Bridges especially over major rivers and in hilly and mountainous areas are very important civil engineering structures. Their role in socio-economic development and defence strategies can hardly be overemphasized. This is unlike tunnels, where alignment is primarily and essentially controlled by geological considerations. But, in the case of bridges also, the design, stability and durability depend, to a great extent, on the subsurface geological conditions that must be properly investigated and cautiously interpreted.
In any major bridge construction project, the designer is keen to place the bridge abutments and piers on as sound, strong and stable rock foundation below as possible. In most cases, if there is river bed below the water is covered by varying thickness of unconsolidated natural deposits of sand, gravels and boulders. Such loose materials are not safe as foundations for bridge piers for at least two reasons:
Firstly, piers placed directly on them would be unstable;
Secondly, the cover material is liable to be removed due to scouring by river water.
As such, the pier must be placed on stable foundation, preferably of rock, under a suitable thickness of cover material so that it is safe from scour by river water.
The height of pier from under the span to the foundation level, therefore, depends on the ‘depth of the bed rock’ below the river water.
Such sound bed rocks might be available within a depth varying from 5 to 20 meters below a river bed or they might not at all be available even up to 100 meter or more.
To achieve this, drill holes are made all along the centre line of the proposed bridge, even on the right or left of it, till they reach the sound rock sequence or up to a reasonable depth. Utmost care is needed not to mistake isolated big boulders buried underneath the river bed as the bed rock. Boulders are rocks but they are not bed rocks and cannot be trusted as foundations for bridge piers.
The very first rock encountered below the bed cover material may not be suitable as a foundation.
It should be kept in mind that three types of loads are to be borne by a bridge pier foundation:
i. The compressive, vertical loads due to the weight of the bridge span and that of pier material;
ii. The horizontal loads due to the thrust of the water flowing above as transmitted directly and through the pier;
iii. The dynamic, complex load, often inclined and shearing in character, due to heavy traffic on the bridge.
Consequently, the bed rock selected as foundation for the pier must be strong enough to bear the sum total of all these loads, not temporarily, but throughout the proposed life of the bridge.
The nature of the bed rock is commonly determined through study of petrological characters and engineering properties, especially the strength values, using the core samples obtained during drilling of test bore holes. In fact complete and very useful geological profiles could be prepared all along the centre line of the proposed bridge from the study of such core logs.
Most igneous and massive type of sedimentary and metamorphic rocks is quite strong, stable and durable as foundations for bridge piers and abutments. The group of weak rocks which might behave badly in the presence of water includes such types as cavernous limestones, chalk, friable sandstones especially with clayey cements, shales, clays, slates, schists and the layers of peat and compressible organic material.
Folding and faulting might cause some uncertainty in establishing a perfect geological profile but are not otherwise negative factors. Acute fracturing and profuse jointing is, however, undesirable at the foundation levels as these might cause settlement beyond the allowable limits.
When the bridge sites are located in the zones of seismic activity, the foundations are required to be designed for additional seismic loads as specified in the codes of respective areas.
In the glaciated areas, special care must be taken to establish the existence of drowned or buried valleys that might be filled by secondary material of most heterogeneous characters. In such cases a bed rock may be encountered only at great depth and it may be desirable to reach it through piles. Therefore the low bridge is better because;
It will cost less and be more structurally sound. The only thing is you would have to make a road down both sides of the valley but that would be more structurally efficient than trying to take the whole span of the valley on one bridge. The low bridge would also be better if there is water beneath the bridge in which is not stated.
The high bridge would cost a lot more and not be as structurally sound accordingly.

1. Which of the following is an example of sexual reproduction? *
a. a cell from a male trout joins a cell from a female trout
b. budding of a hydra
c. bacteria undergoing binary fission
d. fragmentation in planarian worms

Answers

Answer:

A

Explanation:

And keep in mind that binary fission is asexual which is the opposite of sexual reproduction

I think it is A sorry if that isn’t the answer bit that’s what I would pick

The organism has one trait that is shared with bats but not birds. Which group should he choose for the new organism and why?

Answers

The group which should be chosen is Birds because of the homologous structures, the trait shared only with bats is derived.


What is Homologous structure?

These are the physical structures which common ancestors share but however have different functions.

In the case of a Bird which has a common homologous  with the organism depicts that the traits shared with bat is derived because it is analogous and aren't similar in structure thereby making it the correct choice.

Read more about Homologous structure here https://brainly.com/question/7904813

#SPJ1

The correct question is:

A scientist finds a new organism that may be either a bird or a bat, but it is not clear which group it belongs to. He is pretty sure that the organism has analogous structures with bats and homologous structures with birds, as suggested by genomic data. The organism has one trait that is shared with bats but not birds which group should he choose for the new organism and why?

what is an identifying characteristic of the chemical structure of proteins? a. proteins always contain nitrogen atoms. b. proteins have identical repeating units within the structure. c. all carbon atoms in proteins are bonded to at least three hydrogen atoms. d. amine groups are found at both ends of the chemical backbone in proteins. e. the side chains in amino acids have either a positive charge or negative charge.

Answers

Answer: a. proteins always contain nitrogen atoms.

A segment of DNA is known to contain the following base sequence:3' GATACCTTTGTGTAGTCATCTT 5'a) Write the mRNA that would be transcribed from this DNA fragment.b) Circle the starter and the stopper in your mRNA sequence. Write the sequence of amino acids which would be encoded in translation. Use the mRNA codon table provided.c) Where in the cell do transcription and translation occur?

A segment of DNA is known to contain the following base sequence:3' GATACCTTTGTGTAGTCATCTT 5'a) Write

Answers

a) In order to transcribe the segment of DNA, it is important to note that this process is important for gene expression as a protein. An enzyme called RNA polymerase moves along the DNA until the end of the gene, releasing the mRNA. The DNA has two strands: one that goes from 5' to 3' direction, and another one that goes from 3' to 5' direction. The one that's used for transcription will always be the 3' to 5' one, so we already have the correct strand to work with, as it is a 3' to 5' strand.

However, the mRNA will be assembled in the 5' to 3' direction. Using the same complementary base-pairing rules as in DNA, we will pair Cytosine (C) with Guanine (G), but as there is no Thymine (T) in RNA, we will pair Adenine (A) with Uracil (U).

Therefore, the sequence o mRNA read in the 5' to 3' direction is:

5' CUAUGGAAACACAUCAGUAGAA 3'

b) The starter codon is the AUG codon of a messenger RNA (mRNA). Therefore, the sequence of amino acids will start to be decoded there.

The stopper codon can be one of the three following options: UAA, UAG or UGA. In this case, we can only find the UAG codon.

The codons, then will be:

AUG GAA ACA CAU CAG UAG

Then, we can say that the amino acids translated will be:

Met Glu Thr His Gln

(Methionine - Glutamine - Threonine - Histidine - Glutamine

c) In eukaryotes, transcription occurs inside the nucleus of the cell and translation occurs in the cytoplasm.

Explain whether the top or bottom layers would be the oldest layer of sedimentary rock.

explain your answer.

Answers

Answer:

Because sedimentary rock forms in layers, the oldest layer of undisturbed sedimentary rock will be on the bottom and the youngest on top. If the rock layers are bent, they may no longer be in order from oldest to youngest.

The bottom layer would be the oldest layer of sedimentary rock as sediments deposited earlier  will be present at the bottom.

What are sedimentary rocks?

They are the types of rocks which are formed as a result of accumulation of minerals or organic particles at the surface of the earth.Sedimentation is the name given to a collective process which cause the particles to settle.

The study of sedimentary rocks is useful in civil engineering and as important sources of coal, fossil fuels and ores.The color of sedimentary rock is often determined by iron content and sometimes due to the presence of organic matter.

They are classified based on origin in to 4 types which are clastic, biochemical ,chemical and other sedimentary rocks.While based on composition they are classified as siliciclastic,carbonate ,evaporite,organic rich,siliceous ,iron-rich and phosphatic sedimentary rocks.

Learn more about sedimentary rocks,here:

https://brainly.com/question/10709497

#SPJ2

What term BEST describes when evolution of different traits occurs in a recent common related species?

Answers

Answer:

natural selection would be the answer

Explanation:

That means that some of the animals would survive.

________ thousands of tiny projections that add even more surface area to villi​

Answers

Answer:

Each villus, in turn, has thousands of even smaller projections called microvilli (singular: microvillus).

Explanation:

The villi contain capillaries, which are tiny blood vessels. Nutrients are absorbed into these capillaries across the surfaces of the villi and microvilli. Because there are millions of these tiny projections, they greatly increase the surface area for absorption.

What the answer are?

What the answer are?

Answers

The descriptions of the nature of water in the photos can be filled as follows:

1. Capillary action

2. Heat capacity

3. Water as a solvent

4. Polarity

5. Heat of vaporization

6. Density of water and ice

7. Cohesion/adhesion

8. Heat of fusion

9. Surface tension

What is capillary action?

Capillary action is one of the attributes of water that allows it to be through an enclosure without any external help. This is the mechanism of action that is seen in the movement of fluids in a capillary tube.

Also, heat capacity describes the nature of water that allows living things to exist in different environments. This is illustrated in the picture of the bird a warm-blooded animal in its habitat and a cool water body.

Learn more about capillary action here:

capillary action

#SPJ1

Which of the following is a modification of the simple columnar epithelium that allows for efficient absorption along portions of the digestive tract? fibroblasts thin and permeable dense microville cilia

Answers

The correct answer is "microvilli." Microvilli are microscopic, finger-like projections that extend from the apical surface of cells in a simple columnar epithelium. These small structures greatly increase the surface area available for absorption and play a crucial role in enhancing the efficiency of nutrient absorption along portions of the digestive tract.

Within the digestive tract, the simple columnar epithelium lines the surface of organs like the small intestine and large intestine, where nutrient absorption occurs. The presence of microvilli on the surface of these epithelial cells provides numerous benefits for efficient absorption.

Firstly, the abundance of microvilli significantly increases the total surface area available for absorption. This increased surface area allows for a greater contact between the luminal contents (such as digested food) and the absorptive cells, maximizing the absorption of nutrients like carbohydrates, proteins, and fats.

Secondly, the microvilli contain specialized transport proteins and channels that facilitate the absorption of specific molecules. These proteins help transport nutrients across the epithelial cells and into the bloodstream or lymphatic system. The dense packing of microvilli amplifies the presence of these transport proteins, further enhancing absorption efficiency.

Additionally, the microvilli possess a brush-like appearance due to their close arrangement. This brush border aids in trapping and retaining the digested food particles and nutrients, preventing their rapid movement through the digestive tract. This allows for sufficient time for absorption processes to occur.

In contrast to microvilli, cilia are hair-like structures present on certain types of epithelial cells. While cilia have important functions like moving mucus and facilitating the movement of substances, they are not directly involved in absorption along portions of the digestive tract.

Therefore, the modification of the simple columnar epithelium that enables efficient absorption along portions of the digestive tract is the presence of microvilli.

learn more about microvilli here

https://brainly.com/question/33559498

#SPJ11

Which of the following best explains why what we know about cells is called a theory and not a law? (4 points) a We do not have enough evidence yet to call cell theory a law. b We have not reviewed cell behavior enough yet to call it a law. c Cell theory is still changing but may eventually become a law. d Cell theory explains cell behavior where a law would describe it.

Answers

Cell theory explains cell behavior where a law would describe it explains about cells is called a theory and not a law.

What do you mean by cell theory?

Cell theory is a scientific theory first formulated in the mid-nineteenth century, that living organisms are made up of cells, that they are the basic structural/organizational unit of all organisms, and that all cells come from pre-existing cells.

Everything that lives is made up of cells. The second part of cell theory was that new cells are formed from preexisting cells. The third part is that all cells are similar. Finally, cells are the most basic units of life.

The cell theory, or cell doctrine, states that all organisms are composed of similar units of organization, called cells. The concept was formally articulated in 1839 by Schleiden & Schwann and has remained as the foundation of modern biology.

Learn more about cell theory:

https://brainly.com/question/4695161

#SPJ1

1) Explain what a covalent bond is.

Answers

Answer:

its a chemical link between two atoms or ions in where the electron pairs are shared between them :)

Explanation:

Determine the complementary RNA and the amino acids

Determine the complementary RNA and the amino acids

Answers

Explanation:

this is your answer I hope so it is helpful for you

Determine the complementary RNA and the amino acids

What are the 3 domains

Answers

Answer:

Archaea, Bacteria, Eukarya

Answer:

The three domains are Bacteria, Archaea,and Eukarya

Other Questions
If you are given 12M HCL how would you make a 6M of 100mL? SHow the math and explain the process Olinick Corporation is considering a project that would require an investment of $343,000 and would last for 8 years. The incremental cash inflows of the project per year at $107,000. The scrap value of the project's assets at the end of the project would be $23,000. The cash inflows occur evenly throughout the year. The payback period of the project is closest to:___.a) 2.8 years.b) 4.6 years.c) 3.5 years.d) 2.7 years. Suppose that the Federal Reserve is targeting the quantity of funds. If the demand curve shifts outward (up and to the right), what should the Federal Reserve do to the supply curve 9x-3x-5=19 solve for x Which three statements accurately describe the Populist Party?Many farm protest organizations joined the Populist Party in 1892.The Populist Party supported a free silver currency policy.Republican voters were drawn to the Populist Party's platform.The Populist Party wanted more government regulation.The Populist Party wanted the government to subsidize corporations. Will choose brainliest Choose if the linear representation is proportional or nonproportional.A proportionalB nonproportiona A Small Sacrifice1. Which statement from the passage represents a physical change?A. The steel pipes were bent into zigzag shapes which allowed thepipes to sway back and forth in case of an earthquake.B. The steel pipes were made of steel so nothing happens to them.C. The steel pipes reacted with oxygen to form rust.D. The steel pipes are made of steel to transport hot oil. HELP PLEASE.!!!This week Sally withdrew $35 from her bank account and deposited $90 into her bank account. Overall, how much did she add to her bank account. bantam industries has budgeted the following information for march: cash receipts $ 331,000 beginning cash balance 20,000 cash payments 370,000 desired ending cash balance 40,000 if there is a cash shortage, the company borrows money from the bank. all cash is borrowed at the beginning of the month in $1,000 increments, and interest is paid monthly at 1% on the first day of the following month. the company had no debt before march 1. how much cash will the company need to borrow in march? what is the term used for an applicant's written request to an insurer for the company to issue a contract, based on the information provided? the nurse is assigned to care for a newly admitted client. the nurse performs a physical | assessment and reviews the admission form and the primary health care providers prescriptions. which would the nurse identify as the priorities in this client's plan of care? | 0.246 + _________ = 0.558___________ - 0.364 = 9.636 + 0.145 = 0.7363.26 - _____________= 1.780.289 + ____________ = 0.476 ____________ - 4.28 = 7.9Ayuda es para hoy :( What are the coordinates of the image of parallelogram ABCD after a dilation with center (0, 0) and a scale factor of 1/2 the continued existence of a star in any phase of its evolution is a balance between the inward force of Please help me Im having trouble answering this Jackie always knew she was the black sheep in her family, so she moved across the country to live on her own terms. which device of figurative language does the text in bold use? hyperbole metaphor onomatopoeia personification What is going outer space? Answer 5 eight increased by a number *O 8nn - 88/nOn + 8 A. B. C. D. pretty please help me. Also you get 50 points When using a cravat bandage for an injured eye, cover ________ to prevent the injured eye from moving.