Neuroleptic malignant syndrome (NMS) is a rare but potentially life-threatening complication of taking certain medications called neuroleptics, which are used to treat conditions such as schizophrenia and bipolar disorder. the symptoms of neuroleptic malignant syndrome: High fever, Muscle rigidity, Autonomic dysfunction, Confusion or mental changes, Breathing difficulties.
High fever: NMS is characterized by a fever that is often higher than 101.3°F (38.5°C).
Muscle rigidity: NMS can cause stiffness and rigidity in the muscles, particularly in the arms, legs, and neck. This can make it difficult to move or change positions.
Autonomic dysfunction: NMS can also cause changes in blood pressure, heart rate, and breathing, as well as sweating, fever, and changes in blood sugar levels.
Confusion or mental changes: People with NMS may experience confusion, agitation, or changes in consciousness.
Tremors or twitching: NMS may cause tremors or twitching in the muscles, particularly in the face and limbs.
Breathing difficulties: NMS can cause changes in breathing or can lead to respiratory failure.
The treatment of NMS usually involves stopping the use of the neuroleptic drug.
To know more about Neuroleptic malignant syndrome (NMS) here:
https://brainly.com/question/28312523#
#SPJ11
The interval, in which no stimulus whatsoever can produce another action potential, is known as the __________________.
Answer:
It is called the absolute refractory period
Explanation: Hope this helps:)........if not I hope you ind what you're looking for:)
Some of the functions of the skin include all of the following except: Group of answer choices Protect underlying tissues. Regulating body temperature. Synthesize Vitamin D. Make new blood cells.
The one that is not a function of the skin is making new blood cells.
What is skin?Skin is considered a protective layer that covers all your body. This layer is essential for many reasons.
What are the functions of skin?The main functions of this organ include:
Regulating temperature.Producing Vitamin D after sun exposure.Protecting other structures including inner tissues and organs.However, it is not a function of the skin to produce new blood cells, this process occurs inside the bones in an area known as brown marrow rather than in the skin.
Learn more about skin in: https://brainly.com/question/3859045
4. What material is moved through the body in the lymphatic system?
plasma
water
lymph
blood
Answer:
The material that is moved through the body in the lymphatic system is lymph.
If 200 oak trees are counted on a 2 km x 2 km patch of land, what is the density of maple trees per square kilometer?
What is the density of the oak trees per km2?
The density of the oak trees per kilometer square would be 50 trees/\(km^2\).
Population densityTo calculate the density of oak trees per square kilometer, we need to first determine the total area of the 2 km x 2 km patch of land. This can be calculated as:
Total area = length x width
= 2 km x 2 km
= 4 \(km^2\)
The density of oak trees can then be calculated as:
Density = number of trees / total area
= 200/4
= 50 trees/\(km^2\)
Therefore, the density of oak trees per km^2 in the patch of land is 50 trees/\(km^2\).
More on population density can be found here: https://brainly.com/question/1581160
#SPJ1
4. Tia has 15 metamorphic, 8 igneous,
and 7 sedimentary rocks. She displays
her rocks equally in 2 cases. Which
shows how she found the number of
rocks to put in each case? (10-8)
A 2×16
B 16 2
C 2 × 30
D 30 2
Answer:
The answer is D) 30+ 2 15.
Tia has a total of 15+ 8+7=30 rocks. She wants to display them equally in two cases, so she needs to divide the total number of rocks by 2:
30+2=15
Therefore, Tia should put 15 rocks in each case.
Explanation:
if it helped u please mark me a brainliest :-))
what are some examples of viruses
Answer:
Corona, Ebola, Chickenpox, Flu, Herpes, Infectious mononucleosis, etc
Explanation:
Explanation:
Plant viruses: tobacco virus.
Animal viruses: Covid-19, mumps, polio and HIV.
Mycoviruses: viruses that infect fungi.
Oncoviruses: Human Papilloma Virus which causes cervical cancer.
Bacterial viruses: bacteriophages.
The term for a close association between organisms of two or more species is:___.
a. symbiosis.
b. associative living.
c. colonialism.
d. interdependence.
The term for a close association between organisms of two or more species is Symbiosis. Option A. is correct.
Symbiosis is a biological relationship that benefits two different species that are in direct contact. In general, there are three main types of symbiotic relationships, each distinguished by the nature of the benefits that are provided to each species that participates. They are mutualism, commensalism, and parasitism.
Mutualism describes the close association of two or more species in which both benefit. Commensalism describes the close association of two or more species in which one species benefits and the other is neither harmed nor helped. Parasitism describes the close association of two or more species in which one species benefits while the other is harmed.
Therefore, Option A. symbiosis is correct.
To know more about Symbiosis visit-
https://brainly.com/question/31105472
#SPJ11
Label the following diagram using the word bank provided
a = glucose
b = pyruvate
c = acetyl coa
d = fadh2
e = nadh
f = water h20
g = oxygen
h= carbon dioxide co2
A herd of zebras has 9 males and 62 females.
During a one-year period, 22 foals that are born
survive and 25 adults die. Six females join the
herd. Three males and 11 females leave the herd.
Has the herd reached its carrying capacity for this
ecosystem? How do you know?
a. The herd has reached its carrying capacity
because the growth rate is negative.
b. The herd has reached its carrying
capacity because the growth rate
is positive.
c. The herd has not reached its carrying capacity
because the growth rate is negative.
d. The herd has not reached its carrying
capacity because the growth rate
is positive.
Answer:
C. The herd has reached its carrying capacity because the growth rate is negative.
Explanation:
The herd has not reached its carrying capacity because the growth rate is negative. Hence option c is correct.
What is ecosystem?Ecosystem is defined as a location where a bubble of life is created by the interaction of plants, animals, and other species with the weather, topography, and other factors. In ecosystems, biotic and abiotic factors or nonliving components coexist. Human welfare and survival depend on healthy terrestrial ecosystems because they give us access to critical goods and advantages.
Clumps can disperse in a region when there is an unequal distribution of resources like food, water, moisture, temperature, or other materials. the three benefits that one organism might get by coexisting in a population with clumped dispersal. There is more access to food resources, less movement required for individuals to find mates, and improved predator protection for organisms.
Thus, the herd has not reached its carrying capacity because the growth rate is negative. Hence option c is correct.
To learn more about ecosystem, refer to the link below:
https://brainly.com/question/1673533
#SPJ5
can subjects shift their attention to areas of the visual field peripheral to the fixation point without moving their eyes?
Yes, subjects can shift their attention to areas of the visual field peripheral to the fixation point without moving their eyes.
This is known as covert attention and involves directing attention without the need for eye movements. The ability to direct attention without moving the eyes is essential for efficient visual processing, especially in situations where moving the eyes would be inefficient or impractical. Covert attention is thought to be guided by top-down cognitive factors such as task demands and goals as well as bottom-up sensory factors such as salient stimuli or sudden changes in the environment. The neural basis of covert attention involves a network of brain regions including the frontal cortex, parietal cortex, and superior colliculus.Subjects can shift their attention to areas of the visual field peripheral to the fixation point without moving their eyes. Covert attention has been studied extensively using behavioral paradigms such as the Posner cueing task and neuroimaging techniques such as fMRI and EEG. Overall, the ability to shift attention without moving the eyes is an important aspect of visual processing and is essential for efficient visual perception and cognition.
learn more about peripheral
https://brainly.com/question/28217019
#SPJ11
Which of these are part of the respiratory system? (Select all that apply.)
larynx
sinuses
heart
lungs
Answer:
larynx, sinuses, lungs
Explanation:
Answer:
larynx, sinuses, lungs
I know this is old, but just in case anyone else needs it
To cells that are defective in primer removal, you add fluorescent ribonucleotides when the cells are undergoing DNA replication. In this case, you observe that one strand glows more than the other not only near the replication fork but also at intervals along its length. Which strand glows in this way and why?
a. The lagging strand glows in this way because it is synthesized continuously.
b. The leading strand glows in this way because it is synthesized continuously.
c. The leading strand glows in this way because it is synthesized discontinuously.
d. The lagging strand glows in this way because its RNA primers are required for each Okazaki fragment.
The reason the lagging strand lights in this manner is because each Okazaki fragment requires its RNA primers.
what is Lagging strand ?
A single DNA strand called as the lagging strand is replicated in the 5′ - 3′ direction during DNA replication (opposite direction to the replication fork). The lagging strand undergoes periodic infusions of DNA known as "okazaki fragments."
What do you understand DNA synthesis?
DNA replication is the process by which cells obtain a copy of the genome's DNA. A cell must first copy (or reproduce) its entire genome to be able to divide, ensuring that each daughter cell has a complete genome during split.
To know more about DNA synthesis:
brainly.com/question/14137825
#SPJ4
how does calcitonin hormone decrease the concentrations of calcium in the blood
Answer:
It inhibits the activity of osteoclasts, which are the cells responsible for breaking down bone.
Answer:
Calcitonin reduces calcium levels in the blood by two main mechanisms: It inhibits the activity of osteoclasts, which are the cells responsible for breaking down bone.
How does energy change when two objects collide? Think about how potential and kinetic energy work, Explain HELP PLZz!!
As you can see, when objects collide, or bump into each other, it causes the objects' energy to move and change. Objects that have potential energy, or stored energy, are set into motion through collision, and the energy transfers into kinetic energy, the energy of an object in motion.
Answer:
If you can see, it allows objects to rotate and change as objects clash or bump against each other. By collision, objects with potential energy or stored energy are pushed into motion and energy passes into the film energy, the energy of a moving object.
Explanation:
three adaptation of mouse?
Answer:
Mice sense their environment much in the same way as other mammal species. The house mouse has very good vision and hearing. They are equipped with large, cup shaped ears to help sense sound vibrations. They also have a good sense of smell and whiskers which they use to feel surface textures and air movements.penicillin is an antibiotic produced by penicillium fungi. based on what we learned about plant biomolecules, what compound class would penicillin best fit into? secondary metabolite hormone pigment enzyme macromolecule
Penicillin, an antibiotic produced by Penicillium fungi, would best fit into the compound class of secondary metabolites.
Secondary metabolites are organic compounds that are not directly involved in the growth, development, or reproduction of an organism. Instead, they often play roles in defense mechanisms, signaling, or interactions with other organisms. Penicillin is a secondary metabolite because it is produced by Penicillium fungi as a defense mechanism against bacteria. It inhibits the growth of certain bacteria by interfering with their cell wall synthesis.
Penicillin does not fall into the categories of hormones, pigments, enzymes, or macromolecules. Hormones are chemical messengers that regulate various physiological processes in organisms, pigments are compounds responsible for coloration, enzymes are proteins that catalyze chemical reactions, and macromolecules are large molecules such as nucleic acids, proteins, and carbohydrates.
Therefore, based on its role as an antibiotic produced by Penicillium fungi, penicillin is classified as a secondary metabolite.
To learn more about Penicillin click here: brainly.com/question/28214443
#SPJ11
What is the basic unit of a nucleic acid and what is it made of? WILL MARK BRAINLIEST!
the population projection technique that allocates a projected population expansion to subregional areas is called:
The population projection technique that allocates a projected population expansion to subregional areas is called shift share approach.
What is population?
A community's inhabitants who belong to the same species. A population's makeup is influenced by things like density, sex ratios, birth and death rates, immigration, and emigration.
What is sub region?
A biogeographic region's major division. subregional.
Therefore, the population projection technique that allocates a projected population expansion to subregional areas is called shift share approach.
Learn more about population from the given link.
https://brainly.com/question/27859177
#SPJ4
Mitosis is a form ofA. cell fertilization.B. cell division.C. cell specialization.D. cell differentiation.
Mitosis is a process by which the cell divides itself, creating two identical cells. Therefore, the correct answer is B. cell division.
B, mitosis is a form of cell division. Hope this helps! :)
Blowing into a flute can produce a sound because_______.
A. light energy is transformed into sound energy
B. the flute warms the air
C. air expands in the flute
D. air in the flute vibrates
Answer:
D
Explanation:
When you blow in a flute the holes cause vibrations which make sound which make music.
A stationary front occurs when the boundary surface between two air masses does not
1. move
2. rise
3. increase
4. fall ( never mind i found it)
A stationary front occurs when the boundary surface between two air masses does not A. Move.
When does a stationary front occur ?A stationary front occurs when the boundary surface between two air masses does not move. The front is called stationary because the two air masses remain in the same place, with neither one advancing or retreating.
Stationary fronts can result in extended periods of cloudy and wet weather, as warm and cool air masses interact but are unable to displace each other.
Find out more on stationary fronts at https://brainly.com/question/4164670
#SPJ1
Please help!
A. I only
B. II only
C. III only
D. I and III only
Answer:
a
Explanation:
my reason is that the capacity carrying is 35
Answer:
\(\boxed{\mathrm{A. \: I \ only}}\)
Explanation:
The graph does not mention any seasons. The graph is not growing geometrically. For about 9 months the population has been about 35.
What is cleisthenes in 2000 BCE - Ancient Greece
Answer:
Cleisthenes Greek was an ancient Athenian lawgiver credited with reforming the constitution of ancient Athens and setting it on a democratic footing in 508 BC.
Explanation:i dont have one
HindIII is a restriction enzyme that cuts the DNA sequence AAGCTT between the two A bases. How many times would HindIII cut the following DNA molecule?
GTAAGCTTCGACAAGCTTGCTGA
HindIII cut the following DNA molecule 2 times.
Enzymes are proteins that act as biological catalysts with the aid of accelerating chemical reactions. The molecules upon which enzymes may also act are known as substrates, and the enzyme converts the substrates into distinct molecules known as products.
Enzymes are crucial for digestion, liver function, and much more. An excessive amount of or too little of a sure enzyme can reason fitness issues. Enzymes in our blood can also assist healthcare carriers to check for injuries and sicknesses.
Characteristics of enzymes:
* Enzymes are complicated macromolecules with high molecular weight.
* They catalyze biochemical reactions in a cell.
* Enzymes have an effect on the rate of biochemical response and not the direction.
* Enzymes are unique in movement.
* Enzymatic activity decreases with growth in temperature.
Learn more about Enzyme here:-https://brainly.com/question/14577353
#SPJ4
Compare between manual and automatic composting processes
Manual composting involves active participation and manual labor to manage the compost pile, while automatic composting relies on technology and specialized equipment for a more streamlined process.
Overall, the main difference between manual and automatic composting processes lies in the level of human involvement and the use of specialized equipment. Manual composting requires more manual labor and monitoring, while automatic composting relies on technology and automation to manage the composting process.
Learn more about technology here;
https://brainly.com/question/9171028
#SPJ11
The process of maintaining a stable internal environment or
keeping things constant is known as
Answer:
regulation
Explanation:
because is the maintainance of constant environment
What is the least likely result of increased sediment in waterways?
Sediment settles to the river floor
Reduced light for primary producers
Extinction of bottom-dwellers
Blurry vision for predators
i wan na just say so coll like every blurry vision✌
Extinction of bottom dwellers is the least likely result of increased sediment in waterways. Thus, the correct option will be C.
What is the result of sedimentation?Sedimentation is the phenomenon which results in the formation of depositional landforms and also the rocks which constitute the sedimentary records. The building up of various land surfaces through the process of sedimentation, which takes place particularly in the river valleys, and this is called as aggradation.
The sediments which are formed in a waterway's bed, banks and also the floodplain have been transported from higher region in the catchment and are deposited there by the flow of water. Extinction of the bottom-dweller species is the least likely result of the increased sediment in the waterways.
Therefore, the correct option will be C.
Learn more about Sedimentation here:
https://brainly.com/question/14306913
#SPJ3
What is a model system? Please give an example.
Why wasn’t oxidation type chemical weathering common more than 2 billion years ago
Due to deficiency of Oxygen in atmosphere.
How dose common ancestry explain losos’s observations of anoles
Answer:
The correct explanation is given:
Explanation:
Losos observed that the same distribution of anole lizard body types on each of the four large Caribbean islands. After intruding tree-dwelling anoles to small, hurricane-scrubbed islands without trees, the shorter leg lizards are evolved just after a few generations.
DNA evidence suggests that various body-type lizards evolved independently on each of the four large Caribbean islands. These observations show that each of the different body type lizards is developed from a common ancestor only.