The thin skin that appears to form on water’s surface occurs because of

Answers

Answer 1

The thin skin that appears to form on the water’s surface occurs because of capillarity.

What is capillarity?

Capillarity is a physical property of water (H2O) associated with the movement of its molecules.

Capillarity refers to the propensity of water molecules to ascend and decay due to surface tension.

In conclusion, the thin skin that appears to form on the water is due to capillarity.

Learn more about capillarity here:

https://brainly.com/question/23512406

#SPJ1


Related Questions

describe the system of lymph vessels (flow of lymph). explain how lymph is kept moving in the vessels.

Answers

The lymphatic system is an interconnected system of tissues, blood arteries, and organs that transports lymph, a colorless, watery fluid, back into your circulatory system. At the intersection of the left internal jugular and subclavian veins, the lymphatic fluid finally empties.


There are microscopic tubes called lymph capillaries, also known as lymphatic capillaries, all over your body. A capillary is a small tube with a hair-thin inner diameter. Similar to blood capillaries, lymphatic capillaries differ in that they are larger in diameter and have closed ends. Lymph capillaries function similarly to blood capillaries, however they do not let fluid to leave the cell via the cell walls. It is only capable of progress. Your lymphatic system includes lymphatic capillaries. Nearly every organ in your body has lymphatic tissue, organs, and veins that collect surplus fluid. Lymph capillaries assist in maintaining your body's overall fluid balance. Interstitial fluid, which is fluid that fills the crevices between cells, seeps into your tissues from blood capillaries all throughout your body.


To learn more about lymph from the given link: https://brainly.com/question/3760478


#SPJ4


The complete question is:


Describe the system of lymph vessels. Explain how lymph is kept moving in these vessels. Into which veins is lymph emptied?

Someone help me please and thanks :’)

Someone help me please and thanks :)

Answers

2. asexual reproduction

3. different eyecolors in brothers and sisters of the same parents

4a. random means that it is by chance and not determined by science or mathematics.

4b. Mutation is the changing of certain genes over time as being passed down. Similar to evolution.

4c. Genetic mutations are random because according to the punnet square of different traits sometimes it can be 50/50% which trait you inherit.

5. Natural selection is when you may inherit both traits but only one shows due to the fact that one trait is dominant while the other is reccesive.

6. Dominant and reccessive traits determine this. For example brown eyes and dark hair tend to be dominant while blue eyes and blonde hair are recessive. If you have a parent with blue eyes and a parent with brown eyes you will most likely also have brown eyes.

7. the ones that are best fit to the enviorment

The exploration of the mid-Cayman rise is intended to discover _______. a. what life may have been like before the evolution of photosynthesis b. the origins of photosynthesis c. life in shallow, coastal regions d. the chemical composition of undersea mountains Please select the best answer from the choices provided A B C D

Answers

Answer: a. what life may have been like before the evolution of photosynthesis

Explanation:

The mid-Cayman rise is an area that has little light coming in but still has life in it.

Plants are able to provide food for themselves and the rest of us by using photosynthesis to make food. Photosynthesis uses sunlight to make this food.

One would think that photosynthesis was around for as long as plants were around but this is not the case. Life on earth had existed long before photosynthesis became a valuable process to plants.

There is therefore curiosity as to how this life fed itself without using photosynthesis and this is why the life in the mid-Cayman is being explored. The way the life makes food there in the absence of light will shed light on how plants made food before photosynthesis.

Answer:

A

Explanation:

Angeldouglas006 plz answer this question what is soil

Answers

Answer:

Soil are tiny bits of substances that contains animal and plants parts as well as nonliving matter such as rocks. They are compressed together by years of new layers of whatever sitting on top of it (New layers of soil, etc). Erosion also assists in the forming of soil as it may take layers of soil from a forest to another for example.

When the body detects a pathogen, T cells recognize antigens and destroy
infected cells. B cells produce other cells that make antibodies. What type of
immune response is this?
A. Nonspecific
B. Unsympathetic
C. Sympathetic
D. Specific

Answers

Answer:

This type of immune response is specific. T cells recognize antigens and destroy infected cells, while B cells produce other cells that make antibodies. The body is able to recognize and respond to specific pathogens, as opposed to nonspecific responses, which do not differentiate between different types of foreign substances.

give me brainiest

what are 4 cellular activities that would require the energy of ATP?

Answers

Answer:

active transport (moving particles against the concentration gradient)making proteinscell division (for growth and repair)transmission of nerve impulses

Hope this helps!

ATP is the energy currency of the cell and it is required almost everywhere. 4 cellular activities that would require the energy of ATP will be cellular respiration, ion transport, muscle contraction, nerve impulse.

What is the role of ATP ?

The role of ATP is providing energy where it  gets hydrolysed into ADP along with the phosphate ion where the reaction provides energy and this reaction brings about energy in the activity.

The cellular activities are the activities that take place inside the cell and various activities that will link to them in order to perform various functions. DNA synthesis, biochemical reactions, cellular respiration, cellular activities all takes place with the help of ATP.

Therefore, ATP is required almost everywhere in both cellular respiration activities and cellular activities.

Learn more about cellular activities at :

https://brainly.com/question/28030433

#SPJ2

Gastroparesis is a condition that causes a partial paralysis of the stomach. The stomach has reduced ability to contract to move food through the digestive system. Some common symptoms of gastroparesis are abdominal pain, nausea, and feeling full after eating a small amount of food. What would be the most likely cause of this condition? A. damage to nerves that control the stomach B. lack of pancreatic juices and bile C. lack of enzymes in the small intestine D. damage to the mucus lining of the stomach

Answers

Symptoms of this condition include paralysis of the stomach muscles. Muscles are controlled by nerve impulses, therefore the most likely cause for this condition is (A.) damage to nerves that control the stomach

B. lack of pancreatic juices and bile -> this will lead to food not being chemically brokend down properly in the stomach and oils not mixing with water leading to malnutirion

C. Lack of enzymes in the small intestine -> this will also lead to food not being chemically digested and malnutrition

Which statement best describes the inner
core?
A. It is at the very center of the earth and consists of metal.
B. It is the layer responsible for plate tectonics.
C. It is the molten middle layer.
D. It has two layers, continental and oceanic.

Answers

The right matches are:

1. The inner core is matched with F) the solid iron.

The inner core, or seed, is the solid part in the center of the Earth. It is a ball of 1,220 kilometers in radius located in the center of the outer core (liquid). It is composed of an alloy of iron and nickel, as well as lighter elements. The boundary between the outer core and the inner core is called Lehmann's discontinuity, or ICB (for inner core boundary).

2. The outer core is matched with G) very dense liquid of iron and sulfur

The outer core is the liquid part of the Earth's core, an intermediate layer located above the solid seed (inner core) and below the Earth's mantle. Like the seed, the core is a metal alloy, consisting mainly of iron and nickel. The liquid of the outer core is animated by rapid convective movements that induce a dynamo effect at the origin of the Earth's magnetic field.

3. The lower mantle is matched with C) layer just outside of the outer core

The lower mantle is sometimes called the "mesosphere". It extends from 700 to 2900 km deep.

The lower mantle is responsible for a particular phenomenon: hot spots. Hot spots are volcanoes that are not born at the border of two tectonic plates, unlike ordinary volcanoes, but in the middle of these plates. They occur when the god chief and deceased is irregular. The lava from these volcanoes is more gaseous and comes from the depths of the mantle (hence the lower mantle), which allows to deduce the shape of the lava at this level.

4. The upper mantle is matched with B) made of large plates that move

The top of the mantle and the crust form the lithosphere, which can reach 300 km below the continents (since the oceanic crust is much thinner). The part of the lithosphere that is not the crust (hence the top of the upper mantle) is very brittle (which allows it to move). From 200 to 700 km deep, we find the "asthenosphere", which is the plastic part of the upper mantle.

5. The crust layer is matched with D) thin, rigid surface of Earth

The earth's crust is the superficial and solid part of the material from which the Earth is made. This is the upper part of the lithosphere (which constitutes the tectonic plates).

The boundary between the Earth's crust and the upper mantle is the Mohorovicic discontinuity.

The earth's crust exists in two radically different "varieties", the continental crust, of predominantly granitoidal petrological composition, and the oceanic crust of essentially basaltic nature.

6. The lithosphere is matched with E) layer that includes the asthenosphere

The lithosphere is the rigid terrestrial envelope of the Earth's surface. It includes the earth's crust and part of the upper mantle.

It is divided into a number of tectonic plates, also called lithospheric plates.

The lithosphere, relatively rigid on time scales of the order of 1 to 10 Ma, rests on the asthenosphere, solid but ductile, more easily deformable because it consists of rocks under physico-mechanical conditions (pressure, temperature, therefore speed increased deformation), leading to a relatively low viscosity.

7. The asthenosphere is matched with A) platic portion of the upper mantle of the Earth.

The asthenosphere (from the Greek asthenos, without resistance) is the ductile part of the upper terrestrial mantle. It extends from the lithosphere to the lower mantle for 700 kilometers.

This concept emerged in the late 1960s with the plate tectonics revolution and the mesosphere concept. The asthenosphere is between the lithosphere and the mesosphere.

Which of the following are true of fair trade?
1. Workers earn a fair wage
II. Workplace conditions are good
III. All production cost is paid for
IV. A trade deficit is created
A. I, II, III
B. II, III, IV
C. I only

Answers

The answer is B. II, III,IV

The atoms which comprise living organisms are different from those of non-living substances. True false

Answers

True or false:

The atoms which comprise living organisms are different from those of non-living substances. The answer to the question is true. Atoms are the fundamental building blocks of all things in the universe, including living organisms and non-living substances.

However, atoms that make up living things are different from those that make up non-living things. Living organisms, such as humans, animals, and plants, are composed of atoms, but these atoms are organized into molecules, which are subsequently organized into complex biological structures. The key differences between the atoms of living organisms and non-living substances are due to the way they interact with other atoms and molecules in their environment.

The four most abundant elements that make up 95% of the human body are carbon, hydrogen, nitrogen, and oxygen. Carbon is the building block of life because it is capable of forming bonds with other carbon atoms and can also form bonds with hydrogen, oxygen, and nitrogen. Carbon is the only element that can form a wide variety of chemical bonds, which is why it is the foundation of all organic molecules. Non-living substances may contain these same elements, but they do not have the same molecular and structural organization as living organisms.

To sum it up, the atoms which comprise living organisms are different from those of non-living substances.

To know more about organisms visit :

https://brainly.com/question/13278945

#SPJ11

if an organism shows the dominant trait, can you tell just by looking at what its genotype is? and why

Answers

Answer:

you cannot tell exactly what it's genotype, but you know it's one of two genotypes.

Explanation:

if the organism has the dominant trait it can either be Bb or BB.

Some individuals in a population possess traits or characteristics that make them better suited for their particular environment. What happens to these traits with each new generation?

A) These traits will gradually begin to disappear.

B) The traits will become stronger and more dominant.

C) The traits will become more common among the offspring.

D) The number of offspring possessing these traits will stay the same generation after generation.

Answers

C) The traits will become more common among the offspring is correct answer

What is Traits?

Traits are distinguishing characteristics or attributes possessed by an individual that are determined by their genetic makeup and environmental factors. These traits can be physical, such as hair color or height, or behavioral, such as sociability or aggression. Traits can be inherited from parents and passed down through generations, or they can be influenced by environmental factors such as diet or lifestyle. In the context of biology and genetics, traits play an important role in determining an individual's physical and behavioral characteristics, and how they interact with their environment.

With each new generation, individuals with advantageous traits will be more likely to survive and reproduce, passing on those traits to their offspring. Over time, this can lead to a higher frequency of the advantageous traits in the population. This is known as natural selection.

Learn more about Traits from given link

https://brainly.com/question/28542048

#SPJ1

hurry due in five min plz

hurry due in five min plz

Answers

Answer:

It's either D or B, I'm not really sure

Explanation:

In 1972, EPA issued a cancellation order for DDT based on its adverse environmental effects, such as those to wildlife, as well as its potential human health risks. Since then, studies have continued, and a relationship between DDT exposure and reproductive effects in humans is suspected, based on studies in animals.

Human health effects from DDT at low environmental doses are unknown. Following exposure to high doses, human symptoms can include vomiting, tremors or shakiness, and seizures. Laboratory animal studies showed effects on the liver and reproduction. DDT is considered a possible human carcinogen.


. **Describe Darwin's theory of evolution

Answers

Answer:

Darwinism is a theory of biological evolution developed by the English naturalist Charles Darwin and others, stating that all species of organisms arise and develop through the natural selection of small, inherited variations that increase the individual's ability to compete, survive, and reproduce

Explanation:

Answer:

Charles Darwin believed that all organisms come from one organism, and that we evolve trough years.

Explanation:

lol i do not believe in evolution

When the water leaves plants through transpiration, what substance are the
molecules?

Answers

Answer:

they attract the water molecules still in the plant, helping to pull water up through the stems from the roots

Enzyme is lock or Key?

Answers

Enzyme would equal to lock

Compare a water molecule, H2O, to a hydrogen peroxide molecule, H2O2- Which statement is true?

OA. Water and hydrogen peroxide are made from different types of atoms, combined in the same way.
OB. Water and hydrogen peroxide are made from the same types of atoms combined in the same way.
OC. Water and hydrogen peroxide are made from the same types of atoms, but combine in different ways.
OD. Water and hydrogen peroxide are made from different types of atoms, combined in different ways.​

Answers

Answer:

C, Water and hydrogen peroxide are made from the same types of atoms, but combine in different ways.

Explanation:

Water is H2O, also known as 2 hydrogen atoms and 1 oxygen atom. In Hydrogen peroxide, its 2 hydrogen atoms and 2 oxygen atoms. They both include the same atoms but in different formations.

Compare a water molecule, \(H2O\), to a hydrogen peroxide molecule, \(H2O2-\).The statement that is true is water and hydrogen peroxide are made from the same types of atoms, but combine in different ways. Thus, option C is correct.

What is water?

Water is a compound made up of nitrogen and oxygen. It is an inorganic substance which is odorless as well as tasteless, and it is a trasnparent chemical substance and it is the main constituent of hydrosphere of earth.

The chemical formula of water is \(H2O\) and its molar mass is 18.01528 g/mol with density 997 kg/m3. The boiling point of water is 100 degree celsius and melting point of water is 0 degree celsius.

The elements is defined as a substance which cannot be splitted into simpler form or components by any chemical reaction. An element is also known as atom's species that has a particular number of proton.

All the elements such as carbon, oxygen, and hydrogen found in ethanol but when they are seperated from ethanol they have totally different compound. They are pure element and \(ethanol\) is a mixture.\(ethanol\)

Therefore, Compare a water molecule, \(H2O\), to a hydrogen peroxide molecule, \(H2O2-\).The statement that is true is water and \(hydrogen\)\(peroxide\) are made from the same types of atoms, but combine in different ways. Thus, option C is correct.

Learn more about water here:

https://brainly.com/question/19920929

#SPJ2

Help! In which stages of meiosis are the cells considered diploid?

Answers

Answer:

The cell is diploid because the homologous chromosomes are still located within the same cell membrane.

Explanation:

Answer:

homologous chromosomes are still located within the same cell membrane. Only after the first cytokinesis, when the daughter cells of meiosis 1 are fully separated, are the cells considered haploid

Explanation:

why is the african sleeling sickness called trypanasomes?​

Answers

because symptoms can include a disturbed sleep pattern

Answer:

because symptoms can include a disturbed sleep pattern

Explanation:

African trypanosomiasis is a parasitic disease transmitted by the tsetse fly. It gets its nickname 'sleeping sickness' because symptoms can include a disturbed sleep pattern.

Hope this helps

Creates a barrier between the inside of the cell and the outside of the cell​

Answers

Answer:

Cell wall

Explanation:

Can I have brainliest? It would help me out, if not thanks anyways! Hope this helped and have a nice day :)

Answer:

The barrier between the outside of the cell and the inside of the cell is called plasma membrane.

Explanation:

Which of the following are purines?
1. Guanine and adenine
2. Cytosine and guanine
3. Thymine and Uracil
4. Adenine and thymine
5. Uracil and cyostine

Answers

Answer:

1. Guanine and adenine

What qualities do all living things have in common?

Answers

All living organisms need energy to carry out life processes, are composed of one or more cells, respond to their environment, grow, reproduce, and maintain a stable internal environment.

with the term 'spondylolisthesis' if the combining form is spondyl/o meaning 'vertebra' what is the suffix and how does it translate? group of answer choices -listhesis; slipping -esis; a procedure -listhesis; abnormal condiiton -esis; study of

Answers

The combining form "spondyl/o," which means "vertebra," and the suffix "-listhesis," which means "slipping," make up the term "spondylolisthesis."

Spondylolisthesis is a condition that causes one vertebral body to slide forward or backward in relation to the vertebrae above or below it in medical terms. This could be brought on by a birth defect, an injury, or spine degeneration. Depending on the severity of the slip, the condition can result in nerve compression, back pain, and other symptoms. Although it can occur anywhere along the spine, most often in the lower back.

Therefore, "spondylolisthesis" translates to "vertebral slipping."

Know more about spondylolisthesis here: https://brainly.com/question/28474049

#SPJ4

A substitution mutation occurred and changed the 5th base in the DNA from a C to a T. Write the sequence of RNA codons that would result from this kind of mutation. **Separate each codon with a space. TACACGCAATTACCAGGGTAGCCATTGATT

Answers

The sequence of RNA codons resulting from the substitution mutation that changed the 5th base in the DNA from a C to a T is AUGUGCGUUAUCCAGGGUAGCCAAUUGA.

In DNA, the base C (cytosine) pairs with G (guanine), while in RNA, the base C pairs with G. However, due to the substitution mutation, the original C is replaced by a T (thymine) in the DNA sequence.

In RNA, thymine is replaced by uracil (U). Therefore, the RNA codons corresponding to the mutated DNA sequence can be derived by replacing each T with U and maintaining the sequence order.

The original DNA sequence TACACGCAATTACCAGGGTAGCCATTGATT would have the corresponding RNA codons AUGUGCGUUAUCCAGGGUAGCCAAUUGA. Each codon consists of three bases and represents a specific amino acid or a start or stop signal in the translation process of protein synthesis.

It's important to note that the given DNA sequence is provided as a single continuous string, and without additional information about the reading frame or specific gene sequence, it is not possible to determine the precise protein sequence or the functional implications of the mutation.

For more such answers on RNA

https://brainly.com/question/13939644

#SPJ8

What factors do you think might make it possible for a rogue wave to be more than twice the height of the two colliding waves?

What factors do you think might make it possible for a rogue wave to be more than twice the height of

Answers

There are a number of known mechanisms that result in rogue waves, including constructive interference, whereby small, fast waves catch up with slower waves and temporarily coalesce into an exceptionally huge wave.

What rogue wave to be more than twice the height?

According to scientific predictions, storms with stronger winds will occur more frequently during the ensuing decades.

Larger waves and thus bigger and more frequent rogue waves could be produced by more energy, which could result in more destruction and lost ships at sea. Rogue waves don't always occur in the water.

Therefore, Rogue waves can arise on relatively calm seas, while gale force winds can still be a factor.

Learn more about Rogue waves here:

https://brainly.com/question/12374808

#SPJ1

A diet high in phytates, low in animal protein, high in yeast free bread may lead to zinc deficiency causing, poor wound healing strong bones hyper-taste sensations greater folate absorption

Answers

In fact, zinc insufficiency can result from a diet strong in phytates, low in animal protein, and heavy on yeast-free bread. Phytates are substances that bind to zinc, reducing its gastrointestinal absorption potential.

A diet deficient in animal protein can cause a zinc deficit because animal protein is a strong source of zinc. It's possible that yeast-free bread, especially if it's prepared with refined grains, doesn't have a lot of zinc.

A zinc deficit can hinder these processes since zinc is a necessary mineral that is crucial for bone health and wound healing. Additionally, a zinc deficiency can affect how flavours are perceived, including a reduction in the ability to taste certain flavours and a weakening of the sense of smell. Surprisingly, phytates can also be advantageous. They can boost the absorption of folate, which is necessary for cell division and DNA synthesis. Due to the fact that zinc is necessary for the absorption of folate, this action might be constrained in the presence of zinc shortage. In order to prevent zinc deficiency and preserve maximum health, it is crucial to have a balanced and diverse diet that contains sources of zinc, such as meat, seafood, nuts, and seeds.

For more such questions on Phytates

https://brainly.com/question/29654301

#SPJ11

Describing Water Molecules Which of these statements would be true if the water molecule was linear instead of bent? Check all that apply. Water molecules are polar. Water molecules are nonpolar. Water molecules undergo hydrogen bonding. Water molecules have a linear geometry. Water molecules have a bent geometry.

Answers

Answer: These are the correct answers...

-Water molecules are polar

-Water molecules undergo hydrogen bonding

- Water molecules have a bent geomtry

Hope this helps whoever needs it

The statements that are correct about water molecules are:

Water molecules are polar. Water molecules undergo hydrogen bonding.Water molecules have a bent geometry.Water is polar molar due to the unequal sharing of electrons between the atoms and the unsymmetrical shape of the molecule means that a water molecule has two poles - a positive charge on the hydrogen pole (side) and a negative charge on the oxygen pole (side).Water molecules forming hydrogen bonds with one another.Water has a bent shape is that the two lone pair of electrons are on the same side of the molecule.

Learn more:

brainly.com/question/14000034

Describing Water Molecules Which of these statements would be true if the water molecule was linear instead

Luminance response can be tested with a(n) _____. i. near-range photometer ii. telescope photometer iii. illuminance meter

Answers

Luminance response can be tested with an option(d) I or II i.e, near range photometer or telescope photometer.

The luminous intensity per unit area of light traveling in a specific direction is measured photometrically as luminance. It indicates how much light enters, exits, or is reflected from a specific area and falls within a specified solid angle.

The visual system's ability to function depends heavily on luminance and contrast. Vision is impossible without light (luminance = 0), and without contrast, we are unable to see spatial or temporal patterns. The first stage in seeing, which enables all other visual processes, is the capacity to respond to brightness.

A photometer is a tool used to gauge light's characteristics. A photometer can be used to measure a light source's brightness, color, and flux among other attributes. Photometers gather radiation released by the light source to determine the wavelengths of light and atomic emissions.

The complete question is:

Luminance response can be tested with a(n)_____.

I) near-range photometer

II) telescope photometer

III) illuminance meter

A) I only

B) II only

C) III only

D) I or II

To know more about photometer refer to:  https://brainly.com/question/13961371

#SPJ4

How many amino acids must be obtained in the diet because they cannot be made by the body?
5
ΟΟΟΟ
Mark this and return
Save and Exit
Next
Submit

Answers

Answer:

Nine (9) amino acids must be obtained

how is the avian digestive system different than human digestive system?​

Answers

Answer: Because Different animals have evolved different types of digestive systems specialized to meet their dietary needs. Humans and many other animals have monogastric digestive systems with a single-chambered stomach. Birds have evolved a digestive system tIngestion and digestion are two actions that occur in the alimentary canal of animals. The main difference between ingestion and digestion is that ingestion is the taking of food into the body whereas digestion is the breakdown of food into small molecules that can be absorbed by the body.that includes a gizzard where the food is crushed into smaller pieces. hope this helps have a nice night ❤️❤️❤️

Explanation:

how is the avian digestive system different than human digestive system?

Answer: Hello: )

Because Different animals have evolved different types of digestive systems specialized to meet their dietary needs. Humans and many other animals have monogastric digestive systems with a single-chambered stomach. Birds have evolved a digestive system tIngestion and digestion are two actions that occur in the alimentary canal of animals. The main difference between ingestion and digestion is that ingestion is the taking of food into the body whereas digestion is the breakdown of food into small molecules that can be absorbed by the body.that includes a gizzard where the food is crushed into smaller pieces. hope this helps have a nice night. ✨

Explanation:

Other Questions
the study also explains the difference between traditional and digital marketing. The cell membrane isa)semi permeableb)selectively permeable 7. You failed writing part of your English exam. Write a letter to Exam Centre requesting extra points for your essay Assuming a normal distribution, families spends an average of $500 on their monthly cell phone bills with a standard deviation of $75. What is the probability a random families' bill is between $350 and $400 Which underlying cause of prejudice is associated with prejudiced attitudes because of rigid and excessive concerns with obedience and respect?. in which of these molecules or ions does the presence of nonbonding electron pairs produce an effect on molecular shape, assuming they are all in the gaseous state? Find the linear function with the following properties.f(-4) = 7f(-8) = -4 the mental link customers make between a brand and its key product attributes is known as brand blank______. multiple choice question. equity loyalty asset association Japans goal in attacking midway island in june 1942 was to:. Find the circumference of a circle with a diameter of 28 meters. Round your answer to the nearest hundredth. * suppose that a function f has domain (-2,2) and range (-3,5). what is the domain of the function f(2x)? Nadine is making a quilt. she can use a rectangle of any length and width, as long as the angles in the shape are right angles. which pieces of fabric can nadine use in the quilt? check all that apply.fabric 1length: 5 cmwidth: 12 cmdiagonal: 13 cmfabric 2length: 8 cmwidth: 6 cmdiagonal: 10 cmfabric 3length: 4 cmwidth: 5 cmdiagonal: 6 cmfabric 4length: 10 cmwidth: 8 cmdiagonal: 12 cmfabric 5length: 6 cmwidth: 4 cmdiagonal: 8 cmfabric 6length: 8 cmwidth: 15 cmdiagonal: 17 cmfabric 1fabric 2fabric 3fabric 4fabric 5fabric 6 thank you!(4 points) Saab, a Swedish car manufacturer, is interested in estimating average monthly sales in the US, using the following sales figures from a sample of 6 months: 555, 607, 538, 443, 777, 869 Usin The following reference is a: Bland, H. W., Melton, B. F., Bigham, L. E., & Welle, P. D. (2014). Quantifying the impact of physical activity on stress tolerance in college students. College Student Journal, 48(4), 559-568. What is the x-intercept? 2x + 3y = 120 (0,6)O (6.0)0 (0.4)O (4,0) Gram , coccus, chains, catalase -, gamma hemolysis, glucose fermentation, grows slightly on MSA (salt tolerant) other test: mannitol fermentation test results: >80% which other test(s) are recommended to further increase the accuracy of your identification This organism is . The triangle below is equilateral. Find the length of side x in simplest radical form with a rational denominator. i have been inundated with 500 fake responses (indicated by inconsistent responses, extremely quick response times, or made-up facilities in their open-ended responses Which of the following is NOT one of the maintenance and reliability procedures?A. employee empowermentB. keep computerized recordsC. clean and lubricateD. monitor and adjust Solve using set theory, Venn diagrams, tree diagrams, tables, combinations, permutations, and Bayes formula. What is that probability of Build-A-Bear workshop preforming worse after their 2nd fiscal quarter in 2021? 3uild-A-Bear Workshop, Inc. Reports Increased Revenues and Pre- ax Income in Fiscal 2021 Second Quarter Exceeding Both 2020 and 2019 Second Quarter Results and Raises Annual Guidance Generates $94.7 million in total revenues, an increase of 134.7% compared to the fiscal 2020 second quarter and 19.6% compared to the fiscal 2019 second quarter Gross profit margin is 53.2% compared to 18.7% in the fiscal 2020 second quarter and 44.1% in the fiscal 2019 second quarter