the probability distribution for the random variable follows. 20 0.20 25 0.15 30 0.25 35 0.40 a. is this probability distribution valid? explain. - select your answer - b. what is the probability that (to 2 decimals)? c. what is the probability that is less than or equal to (to 2 decimals)? d. what is the probability that is greater than (to 2 decimals)?

Answers

Answer 1

The probability distribution is valid, we can add up the probabilities of all possible values to get 1.

a.  P(X = 20) + P(X = 25) + P(X = 30) + P(X = 35) = 0.20 + 0.15 + 0.25 + 0.40 = 1. Therefore, this probability distribution is valid.

b. Probability that P(X > 20) is obtained by summing probabilities of X = 25, X = 30, and X = 35 since these are the values greater than 20.P(X > 20) = P(X = 25) + P(X = 30) + P(X = 35) = 0.15 + 0.25 + 0.40 = 0.8

c. Probability that P(X ≤ 25) is obtained by summing the probabilities of X = 20 and X = 25, since these are the values less than or equal to 25.P(X ≤ 25) = P(X = 20) + P(X = 25) = 0.20 + 0.15 = 0.35

d. Probability that P(X > 30) is obtained by summing the probabilities of X = 35 since this is the only value greater than 30.P(X > 30) = P(X = 35) = 0.40Therefore, the probability distribution is valid. P(X > 20) = 0.8, P(X ≤ 25) = 0.35, and P(X > 30) = 0.40.

Therefore, since we can add up the probabilities of all possible values to get 1, we can conclude that the probability distribution is valid.

To know more about probability refer here:

https://brainly.com/question/30034780

#SPJ11


Related Questions

The area of a swimming pool is 86.52 square feet. The Width of the pool is 8.4 feet. What is the length?

Answers

Answer:

10.3

Step-by-step explanation:

divide 86.52 by 8.4

8.4 x 10.3 equals 86.52

Find at least three different sequences beginning with the terms 3, 5, 7 whose terms are generated by a simple formula or rule.

Answers

Answer:

3 5,7,9,11,13,16,17 19,21,23,25,27,29

Find an equation for the line below

Find an equation for the line below

Answers

I dislike this kind of math, pointless in my eyes

Which of the following equations is true

Which of the following equations is true

Answers

Its the last one because 10 times 1 is 10 and 0 plus 10 still gives you 10
The last one is the answer

Write an expression which is equivalent to w(4w3 + 8w4) – (5w3 – 2w5)

Answers

Answer:

4w4 + 10w5 - 5w3

Step-by-step explanation:

In 1983, a pair of jeans cost $66.35. If a pair of jeans costs $118.10 today, what is the CPI? a. 152 b. 156 c. 178 d. 184 Please select the best answer from the choices provided A B C D

Answers

The value of CPI will be 178.

What is an expression?

Mathematical expression is defined as the collection of the numbers variables and functions by using operations like addition, subtraction, multiplication, and division.

Given that;

In 1983, a pair of jeans cost $66.35.

And, A pair of jeans costs $118.10 today.

Now,

Since, In 1983, a pair of jeans cost $66.35.

And, A pair of jeans costs $118.10 today.

Hence, The value of CPI will be;

CPI = 118.10 × 100 / 66.35

      = 11810 / 66.35

       = 178

Thus, The value of CPI will be 178.

Learn more about the mathematical expression visit:

brainly.com/question/1859113

#SPJ1

Please help and explain pleaseeeeee

Please help and explain pleaseeeeee

Answers

The perimeter of the figure or the amount of black cord required is given by P = 110.18 feet

The amount of fabric required for each figure is given by A = 222.985 feet²

What is the Perimeter of a Rectangle?

The perimeter P of a rectangle is given by the formula, P=2 ( L + W) , where L is the length and W is the width of the rectangle.

Perimeter P of rectangle = 2 ( Length + Width )

Given data ,

Let the perimeter of the figure be represented as P

Let the amount of fabric required be A = area of the figure

Now , the length and width of the perimeter of rectangle are 16 feet and 10 feet respectively

The height and base of the triangle is 1.73 feet and 2 feet respectively

The side length of the square is 7 feet

The circle at the center has a diameter of 3 feet so the radius is 1.5 feet

Now , the perimeter of rectangle P = 2 ( L + B ) = 2 ( 16 + 10 )

The perimeter of rectangle = 2 x 26 = 52 feet

The area of rectangle = 16 x 10 = 160 feet²

The perimeter of 4 triangles = 4 x ( 3 x 1.73 ) = 20.76 feet

The area of 4 triangles = 4 ( ( 1/2 ) x 1.73 x 2 ) = 6.92 feet²

The circumference of the circle = 2πr = 2 x 3.14 x 1.5 = 9.42 feet

The area of circle = πr² = 3.14 x 1.5 x 1.5 = 7.065 feet²

The perimeter of square = 4a = 4 x 7 = 28 feet

The area of square = a² = 49 feet²

Now , the amount of black cord required = perimeter of rectangle + perimeter of 4 triangles + circumference of the circle + perimeter of square

The amount of black cord required P = 110.18 feet

And , the amount of fabric required A = area of rectangle + area of 4 triangles + area of circle + area of square

The amount of fabric required A = 222.985 feet²

Hence , the amount of black cord required is 110.18 feet and the amount of fabric required is 222.985 feet²

To learn more about perimeter of rectangle click :

https://brainly.com/question/15725265

#SPJ1

NOTE: This is a multi-part question. Once an answer is submitted, you will be unable to return to this part. Find the number of bit strings that satisfies the given conditions. The bit strings of length 7 having at least four 1s

Answers

64 is the number of bit strings that are of length 7 having at least four 1s. This can be obtained by finding each of the required combination and adding them.  

Find the number of required bit strings:Bit: Bit is a digit which is either zero or one.    Bit string: Bit string is a string of bits. A bit string is a string that contains 0 and 1 only.Byte: Byte is a string of 8 bits.  

If length of the string is n, then there are 2ⁿ bit stings of length n.

We apply combination formula for this,

                ⇒    ⁿCr = n!/(n-r)!r!                        

At least four 1s is 4, 5, 6, 7,  

⇒ ⁷C₄ + ⁷C₅ + ⁷C₆ + ⁷C₇ = 35 + 21 + 7 + 1

⇒ ⁷C₄ + ⁷C₅ + ⁷C₆ + ⁷C₇ = 64

Hence 64 is the number of bit strings that are of length 7 having at least four 1s.      

                             

 

Learn more about bit string here:

brainly.com/question/14229889

#SPJ4  

Badia is the apprentice at the local screws and nails factory. The other day she made some six - inch nails. Charli who works next to her made one and half times as many as Badia, but Siva made twice as many as Charli. They all made a total of 110 six - inch nails.
45. How many did Badia make?
46. How many did Charli make?
47. How many did Siva make?

Answers

Answer:

   45. 20

   46. 30

   47. 60

Step-by-step explanation:

Let :

Badia = xCharli = 1 1/2x = 1.5xSiva = 2(1.5)x = 3x

Solving

x + 1.5x + 3x = 1105.5x = 110x = 20

Solution

Badia = 20Charli = 30Siva = 60

Answer:

Badia made 20 nails

Charli made 30 nails

Siva made 60 nails

Step-by-step explanation:

Let b = number of nails Badia made

Let c = number of nails Charli made

Let s = number of nails Siva made

Given:

Charli made one and half times as many as Badia

⇒ Equation 1:    c = 1.5b

Given:

Siva made twice as many as Charli

⇒ Equation 2:    s = 2c

Given:

They all made a total of 110 nails

⇒ Equation 3:    b + c + s = 110

Substitute Equation 1 into Equation 2:

⇒ s = 2(1.5b) = 3b

Substitute s = 3b and Equation 1 into Equation 3 and solve for b:

⇒ b + c + s = 110

⇒ b + 1.5b + 3b = 110

⇒ 5.5b = 110

⇒ b = 20

Substitute found value of b into Equation 1 and solve for c:

⇒ c = 1.5b

⇒ c = 1.5(20)

⇒ c = 30

Substitute found value of c into Equation 2 and solve for s:

⇒ s = 2c

⇒ s = 2(30)

⇒ s = 60

Therefore:

Badia made 20 nailsCharli made 30 nailsSiva made 60 nails

These triangles
are congruent by
the triangle
congruence
postulate [? ]
A. AAS
B. ASA
C. Neither, they are not congruent

These trianglesare congruent bythe trianglecongruencepostulate [? ]A. AASB. ASAC. Neither, they are not

Answers

Answer:

ASA...............................

A population of insects, in thousands, can be molded using the function (t)= 1.75(0.97)x

Answers

Question:

A population of insects, in thousands, can be modeled using the function

\(p(t) = 1.75(0.97)^t\), where t is time in months. Which statement best

describes the population of insects?

A. The population is decaying at a rate of 3% each month.

B. The population is decaying at a rate of 25% each month.

C. The population is growing at a rate of 75% each month.

D. The population is growing at a rate of 97% each month.

Answer:

A. The population is decaying at a rate of 3% each month.

Step-by-step explanation:

Given

\(p(t) = 1.75(0.97)^t\)

Required

True statement about the function

From the options, we can see that we are to answer the question on the basis of decay and growing rates.

An exponential form is:

\(y=ab^x\)

Compare to \(p(t) = 1.75(0.97)^t\)

\(b= 0.97\\\)

If \(b > 1\), then \(b = 1 + r\) r represents growth rate

else, \(b= 1-r\) r represents decay rate

Since b < 0.97:

\(0.97= 1-r\)

\(r = 1 - 0.97\)

\(r = 0.03\)

\(r = 3\%\)

\(r = 0.03\)

A consumer has a utility function u(x1,x2)=x1α+x2a and a budget constraint p1x1+ p2x2=m. For what values of α does this utility function produce 'good' indifference curves? Derive this consumer's demand functions and show that they are homogeneous of degree zero in (p1,p2,m).

Answers

The utility function given is u(x1,x2) = x1^α + x2^a, where x1 represents the quantity of good 1 consumed, x2 represents the quantity of good 2 consumed, and α and a are exponents. The consumer's demand functions are homogeneous of degree zero in (p1, p2, m)

To determine the values of α for which this utility function produces 'good' indifference curves, we need to consider the marginal rate of substitution (MRS). The MRS measures the rate at which a consumer is willing to trade one good for another while keeping utility constant.
The MRS is given by the ratio of the marginal utility of good 1 to the marginal utility of good 2: MRS = (MU1 / MU2).
In this case, the marginal utility of good 1 is αx1^(α-1) and the marginal utility of good 2 is ax2^(a-1).
So, the MRS = αx1^(α-1) / ax2^(a-1) = α / a * (x1 / x2)^(α-1-a).
For 'good' indifference curves, the MRS should be constant along the curve. This means that α / a * (x1 / x2)^(α-1-a) should be constant.
To satisfy this condition, α-1-a must be equal to 0. Solving this equation, we get α = a - 1.
Therefore, for 'good' indifference curves, the value of α should be equal to a - 1.
Now let's derive the consumer's demand functions. Given the budget constraint p1x1 + p2x2 = m, where p1 is the price of good 1, p2 is the price of good 2, and m is the consumer's income.
To find the demand functions, we need to maximize the utility function subject to the budget constraint. This can be done using the Lagrange multiplier method.
Setting up the Lagrangian: L = u(x1,x2) - λ(p1x1 + p2x2 - m).


Taking the partial derivatives of L with respect to x1, x2, and λ and setting them equal to 0, we get:
∂L/∂x1 = αx1^(α-1) - λp1 = 0,
∂L/∂x2 = ax2^(a-1) - λp2 = 0,
∂L/∂λ = p1x1 + p2x2 - m = 0.
Solving these equations, we find:
x1 = (α/λp1)^(1/(α-1)),
x2 = (a/λp2)^(1/(a-1)).
Now, let's check if the demand functions are homogeneous of degree zero in (p1, p2, m). Homogeneity of degree zero means that if we multiply all prices and income by a positive constant, the demand functions remain the same.
Let's consider the demand function for x1. If we multiply p1 and m by a positive constant k, we have:
x1 = (α/(λkp1))^(1/(α-1)).
Since α-1 = a, we can rewrite this as:
x1 = (α/(λkp1))^(1/a) * (k^(-1/a)).
The term (k^(-1/a)) cancels out with the (1/(α-1)) term, leaving us with:
x1 = (α/(λp1))^(1/a).
Similarly, we can show that the demand function for x2 remains the same.
Therefore, the consumer's demand functions are homogeneous of degree zero in (p1, p2, m).

To know more about marginal rate of substitution (MRS) refer to:

https://brainly.com/question/33744113

#SPJ11

Solve:

three and two fourths plus five and four elevenths equals blank

Answers

1 5/8

Trust me :)

If it's wrong then sue me instead :D

for each value of x determine whether it is a solution to x<11

Answers

Answer: you need to add a picture

Step-by-step explanation:

so people know what kinda of problem there trying to figure out

The town of Todsham currently has a population of 300,000.
Each year, the population of Todsham will reduce by 5%.
How many fewer people will live in Todsham in 6 years compared with
now?
Give your answer to 3 s.f.
TY

Answers

The number of fewer people living in Todsham in 6 years compared with now, found using the formula for population growth rate, is about 79,500 people

What is the formula for finding the population growth rate?

The formula for finding the population of a town after a specified number of years, where the rate of change of the population, and the number of people in the town are known can be presented as follows;

P = A·(1 - r)ˣ

Where;

P = The current population of the town = The population after the indicated duration

A = The initial population of the town = 300,000

r = The population growth rate = 5%

The population after 6 years is therefore;

P = 300,000 × (1 - 0.05)⁶ ≈ 220,527

The number of fewer people living in Todsam in 6 years = 300,000 - 220,527 = 79473 ≈ 79,500

Learn more on population growth rate formula here: https://brainly.com/question/11774024

#SPJ1

Express the following linear equations in the form ax+by+c= 0 and indicate the values of a, b and c in each case: (1) y = x/5​

Answers

Answer:

Did the question get cut off?

a = -(1/5)

b = 1

c = 0

Step-by-step explanation:

y = x/5 may be rewritten as y = (1/5)x

y = (1/5)x

y - (1/5)x = 0

- (1/5)x + y + 0 = 0

   ax  +   by   + c = 0

a = -(1/5)

b = 1

c = 0

Find the nth Maclaurin polynomial for the function. f(x) = e⁻ˣ, n = 5

Answers

The Maclaurin polynomial for f(x) = e⁻ˣ and n = 5 is given by

f(x) ≈ 1 - x + (1/2)x² - (1/6)x³ + (1/24)x⁴ - (1/120)x⁵.

The function is equal to

f(x) = e⁻ˣ

n = 5

To find the nth Maclaurin polynomial for the function f(x) = e⁻ˣ,

find the nth derivative of f(x) evaluated at x = 0.

Find the derivatives of f(x),

f(x) =  e⁻ˣ

d/dx (f(x)) = - e⁻ˣ

d²/dx² (f(x))  =  e⁻ˣ

d³/dx³ (f(x)) = - e⁻ˣ

d⁴/dx⁴ (f(x)) =  e⁻ˣ

d⁵/dx⁵ (f(x)) = - e⁻ˣ

Now, let us evaluate these derivatives at x = 0,

f(0) = e⁰

     = 1

d/dx (f(0)) = -e⁰

      = -1

d²/dx² (f(0))= e⁰

       = 1

d³/dx³ (f(0)) = -e⁰

       = -1

d⁴/dx⁴ (f(0)) = e⁰

       = 1

d⁵/dx⁵ (f(0)) = -e⁰

         = -1

The even derivatives evaluated at x = 0 are 1,

and the odd derivatives evaluated at x = 0 are -1.

Now, let us write the nth Maclaurin polynomial using these derivative values,

f(x) ≈ f(0) + d/dx (f(0))x + d²/dx² (f(0))/2!)x² + d³/dx²³ (f(0))/3!)x³+ d⁴/dx⁴ (f(0))/4!)x⁴ + ... +dⁿ⁻¹/dxⁿ⁻¹ (f(0))/n!)xⁿ

For n = 5, the 5th Maclaurin polynomial for f(x) is,

f(x) ≈ 1 - x + (1/2!)x² - (1/3!)x³ + (1/4!)x⁴- (1/5!)x⁵

Simplifying further,

f(x) ≈ 1 - x + (1/2)x² - (1/6)x³ + (1/24)x⁴ - (1/120)x⁵

Therefore, the 5th Maclaurin polynomial for f(x) = e⁻ˣ is equal to

f(x) ≈ 1 - x + (1/2)x² - (1/6)x³ + (1/24)x⁴ - (1/120)x⁵.

learn more about Maclaurin polynomial here

brainly.com/question/32574050

#SPJ4

In each of problems 14 through 20, find all eigenvalues and eigenvectors of the given matrix.

Answers

In each of problems 14 through 20, you need to find all eigenvalues and eigenvectors of the given matrix.

Start by finding the characteristic equation of the matrix by subtracting λ (lambda) from the diagonal elements of the matrix and setting the determinant equal to zero.  Solve the characteristic equation to find the eigenvalues (λ).  For each eigenvalue, substitute it back into the matrix and solve the equation (A - λI)x = 0 to find the eigenvectors (x).  Normalize the eigenvectors by dividing them by their magnitude to get the unit eigenvectors.

Repeat these steps for each problem (14 through 20) to find all the eigenvalues and eigenvectors of the given matrix.

To know more about matrix, visit:

https://brainly.com/question/28180105

#SPJ11

In the rainforest of Puerto Rico, I needed to measure the height of a really tall tree. I used a device to measure the angle of elevation from my line of sight to the top of a tree to be 31°. Find the height of the tree if my height is 6 feet and I was 275 feet from the tree

Answers

Answer:

Step-by-step explanation:

See image

In the rainforest of Puerto Rico, I needed to measure the height of a really tall tree. I used a device

I sincerely need help because I don’t understand. please write an equation and how to answer AT LEAST one question.

I sincerely need help because I dont understand. please write an equation and how to answer AT LEAST

Answers

C is incorrect because 1/5 divided by 4 is .05 and 1/9 is .111
a- correct
b- correct
c- incorrect
d- incorrect

4 bags of sand and 20 kg of cement weigh 100 kg altogether, how
heavy is one bag of sand?


One bag of sand
is_________
kg.

Answers

20kg each bag…………………..

Answer:

One bag of sand is 20kg.

Step-by-step explanation:

100 - 20 = 80

80/4 = 20

WHOEVER ANSWERS FIRST GETS BRAINLIEST AND I NEED AN EXPLANATION PLZ

 WHOEVER ANSWERS FIRST GETS BRAINLIEST AND I NEED AN EXPLANATION PLZ

Answers

1:you add the numbers 2:you have to the distribute property

Answer:

Q7: -4 ; Q8: 2.6x + 8

Step-by-step explanation:

For the first one, since they are like terms, you can just normally subtract:

3x - 7x = -4x

Its a negative since 3 - 7 = -4 not positive 4.

You did question 8 correctly.

Study the illustration. Write the ratio
of flowers to bees. Complete the sentence.
For every 5 flowers there are _______
bees.

Study the illustration. Write the ratioof flowers to bees. Complete the sentence.For every 5 flowers

Answers

Answer: 6 bees

Step-by-step explanation:

The picture has 12 bees and 10 flowers. Thus, the ratio of flowers to bees is 10 to 12, which simplifies to 5 to 6.

Therefore, for every 5 flowers, there are 6 bees.

a(n) ____ is a named memory location whose value can vary.

Answers

A variable is a named memory location whose value can vary. It is a fundamental concept in computer programming as it allows programmers to store and manipulate data in their programs.

Variables are typically assigned a data type, such as integers, strings, or booleans, which determines the kind of data that can be stored in the variable. Variables can be used to store input from the user, perform calculations, and store results. They can also be used to control the flow of a program through conditional statements and loops. Overall, variables are an essential building block for programming and allow for the creation of dynamic and responsive programs.


A variable is a named memory location whose value can vary. In programming, variables are used to store and manipulate data, such as numbers, text, or other information. When a variable is declared, the computer reserves a specific portion of memory to store its value. Throughout the execution of a program, the value of a variable can be changed or updated as needed. This allows programmers to write flexible and dynamic code, making it easier to adapt to different scenarios and user inputs. Variables are essential in programming and are used in nearly every type of application or system.

Learn more about programming at: brainly.com/question/11023419

#SPJ11

the distance a falling object travels towards the earth is directly proportional to the square of the time that it falls. if an orange falls 16 feet in 4 seconds, how far will it fall in 8 seconds ?

Answers

The orange will fall 64 feet in 8 seconds.

Distance:

Distance is defined as how much ground an object has covered despite its starting or ending point.

Given,

The distance a falling object travels towards the earth is directly proportional to the square of the time that it falls.

And an orange falls 16 feet in 4 seconds.

Here we need to find the how far it will fall in 8 seconds.

Based on the given details,

We know the that distance is,

D = kt²  

where

k is the constant of proportionality.  

To find the value of k we have to apply the given values on the equation.

=> 16 = k x (4)²

=> 16 = k x 16

=> k = 16/16

=> k = 1.

So, in 8 seconds it will fall at

=> D = 1 x (8)²

=> D = 1 x 64

=> D = 64 feet.

Therefore, the orange will fall at 64 feet in 8 seconds.

To know more about Distance here

https://brainly.com/question/15172156

#SPJ4

Sammy bought 3 pounds of oranges that cost $4.59. Determine the cost of 1 pound.

Answers

The cost of 1 pound of oranges is $1.53

covert this repeating decimal into a fraction

covert this repeating decimal into a fraction

Answers

Answer: 4311/9900 or 479/1100

Step-by-step explanation:

Okie so in order to do this, we need to get rid of the repeating part of the decimal

==============================================================

Right now we have x = 0.435454545454...

If we multiply this by 100, we get

100x = 43.545454545454

And if we multiply by 10000 we get

10000x = 4354.5454545454

==============================================================

Subtract the two equations

10000x = 4354.5454545454

100x = 43.545454545454

------------------------------------------------- (notice: the repeating part will cancel out)

9900x = 4311

x = 4311/9900

If you simplify the fraction you get: 479/1100

The fraction that represents the repeating decimal is

\(\frac{479}{1100}\)

Given :

A repeating decimal  \(0.4354545454...............\)

there is bar at 54 , so 54 is repeating

We need to convert this decimal into fraction

54 is repeating so we multiply by 100

Let x= \(0.4354545454...............\\\)

\(100x=43.54545454...............\)

Now we subtract x from 100x

\(100x=43.54545454...............\\ x= 0.4354545454...............\\-----------------------------------------\\ 99x=43.11\)

Now divide both side by 99

\(x=\frac{43.11}{99} \\\)

multiply top and bottom by 100 to remove the decimal

\(x=\frac{4311}{9900} \\Divide \; top \; and \; bottom \; by 9\\x=\frac{479}{1100}\)

Learn more :

brainly.com/question/15666599

Brainliest for the correct answer 20 points!!!

Brainliest for the correct answer 20 points!!!

Answers

Answer:

y = -3/2x + 3

Step-by-step explanation:

Answer:

y= 3 - 2x

Step-by-step explanation:

10 points! Daryl has a scholarship that pays 80% of his tuition for all four years he attends college. What is the total value of the scholarship if the tuition is $13,500 per year?

Answers

Answer:

The value of the scholarship is $10800

Step-by-step explanation:

Step one:

Daryl has a scholarship that pays 80% of his tuition per year

the total value of the scholarship if the tuition is $13,500 per year

Step two:

let us solve for the value of 80% of the tuition which is $13,500 per year.

this is calculated as

=80/100*13,500

=0.8*13,500

=10,800

3. If 480 movie tickets were sold on Saturday,
how many were child tickets?

Child= 15%
Adult= 75%
Senior=10%

3. If 480 movie tickets were sold on Saturday,how many were child tickets?Child= 15%Adult= 75%Senior=10%

Answers

72 child tickets.

360 Adult tickets.

40 senior tickets.

Hope this helps!!

:)

^sorry if I’m wrong!!^

Answer:

72 child

369 adult

48 senior

Other Questions
Which of the following describes an important difference between NADH and NADPH?A. NADPH is exclusive to a small number of cellsB. NADH is produced in glycolysis while NADPH is used in a wide variety of pathwaysC. NADH is primarily produced in catabolic reactions while NADPH is primarily used in anabolic reactionsD. NADH is more likely to give up electrons than NADPH what are the similarities and differences between the two creation accounts in genesis describing the middle ages as the dark ages: only takes into account western europe. refers to the fact that earth got less sunlight during this time period. describes the spot that covered cities from industrial factories. is an accurate description of a time when literacy almost vanished across the world. when isolation between the production and marketing departments is so great that production does not get appropriate feedback, it is an example of a(n) blank . multiple choice question. disadvantage to departmentalization advantage to a narrow span of control disadvantage to a broad span of control disadvantage to centralized authority disadvantage to decentralized authority May 9, 2 p.m. Both you and your partner go to the Limitville County Hospital to check on the passenger, who is the driver's wife, Emily Samples. You speak to the admitting doctor, Dr. Anthony Pallor, who indicates that Mrs. Samples is still in a coma, but in stable condition. You speak to the family members, offering sympathy. You also ask them a few questions. In your crime scene notebook:Determine three questions you should ask Mrs. Samples's doctor.Determine three questions you should ask the family members.May 10, 8 a.m.At your office, you use a nationwide database to conduct a search on any charges or violations regarding Peter Samples and his wife, Emily Clairmont Samples. In your crime scene notebook:Why conduct a search on both occupants criminal histories?May 10, 9:30 a.m.You are able to obtain the officers report from the interview of the driver of the white SUV, Carl Minus. In the report, Mr. Minus indicates that he did not see the accident nor did he hear it. He came upon it around 9:50 p.m. on May 8, when his headlights showed the car smashed into the tree. He immediately pulled off to the side of the road and approached the vehicle, calling out to the victims in the car. He used the flashlight on his cellphone to look into the car and could not determine if either of them were alive. He then called 911 at approximately 9:52 p.m. to report the incident. After checking with the 911 logs, you confirm the time frame given by Mr. Minus.In your crime scene notebook:Clarify why it is necessary to corroborate the report and the 911 logs.May 10, 12 p.m.You call the hospital for an update on Mrs. Samples condition and are notified that she is still in a coma.May 10, 2 p.m.You and your partner go to the impound lot to look at the Samples' car and make sure you did not miss anything. You reexamine the point of impact on the car and take measurements of the indentation damage done to the car. In your crime scene notebook:Theorize how the measurements of the indentation damage would correlate to the speed of the car.What other evidence could give an indication as to the speed of the car?May 11, 8:30 a.m.You receive the toxicology report from Temper Labs.In your crime notebook:What drug(s) were present in Mr. Samples's body that could cause impairment?For your state, look up the legal limit of alcohol allowed. Is Mr. Samples below or above the legal limit?Revise your hypothesis based on the new evidence.Write a summary report as to the probable cause of the accident. Include evidence to support your findings. In your report, mention what may hinder you from making it conclusive.Part 2: Accessthe Blood Alcohol Level (BAC) calculator.Use the calculator to find these answers:Monday: One couple at the bar drank red wine, and each had one glass between 9 and 10 p.m. What was the BAC for the 200 lb man and the 120 lb woman when they went home at midnight?Tuesday: Another night, the same couple each drank one glass of wine every hour for four hours, beginning at 8 p.m. What was the BAC of each person at the end of that night? They went home at midnight.Saturday: The same couple returned for drinks. On Saturday night, she drank two cosmopolitans and he drank four stout beers between 8 and 10 p.m. What was the BAC of each person at the end of the night? They went home at midnight.What nights should they have taken a taxi to get home?What does the statement "If you drink, drink responsibly" mean?In your crime scene notebook:Your responses to each bullet task must include one statement answering the question and justifying the answer with numerical evidence. The risk of lending to two of these four companies below is higher compared to the remaining two companies. Identify the two companies that have a higher lending risk. Description A B D Company Company Company Company Stage of Newly Rapid Trying to Maturity & Growth of Started growth Break Consolidation the Even Prospective Borrower O A Company and B Company. O B Company and C Company. O C Company and A Company. OD Company and A Company. Suppose that a category of world class runners are known to run a marathon (26 miles) in an average of 146 minutes with a standard deviation of 15 minutes. Consider 49 of the races. Let X = the average of the 49 races.Find the probability that the average of the sample will be between 143 and 147 minutes in these 49 marathons. (Round your answer to four decimal places.)Find the 60th percentile for the average of these 49 marathons. (Round your answer to two decimal places.)______ minFind the median of the average running times._____min jim buys car insurance for his new sports car, and because he convinces the insurance company that he is a good driver, they charge jim low premiums. the truth, however, is that jim is a thrill seeker, and he is afflicted by moral hazard. this probably means that a. he drives more recklessly because he knows that the insurance company will cover the cost of an acciden The capital structure for Craig Corporation is provided below. The company plans to maintain its capital structure in the future. If the firm has a 6% after tax cost of debt, a 12% cost of preferred stock, and an 14% cost of common stock, what is Craig Corporations weighted cost of capital.Capital Structure__________________________________Bonds $325,000Preferred stock 525,000Common stock 650,000Total $1,500,000a. 11.6b. 12.4c. 9.7%d. 8.5% Oriole Company is considering purchasing equipment. The equipment will produce the following cash inflows: Year 1, $32.500; Year 2,$36,500; and Year 3. $47,000. Oriole requires a minimum rate of return of 8%.What is the maximum price Oriole should pay for this equipment? These are grades for student X in a certain courseGrades (%): 75, 59, 68, 82, 95, 51, 88, 62, 76This is an example of: Which of the following isotopes would you expect to be stable?A. 234PaB. 4HeC. carbon-12D. uranium-238E. 58Ni 50 Points! Multiple choice geometry question. Photo attached. Thank you! Which of the following answers best indicates the semantic property that the (a) and (b) words shown below share AND the semantic properties that distinguish the (a) and (b) words? (a) woman, nurse, daughter, seamstress (b) cow, duck, doe, sow The (a) and (b) words are (female), the (a) words are [occupation), and the (b) words are [food]. The (a) and (b) words are (female), the (a) words are [human), and the (b) words are [animal]. The (a) and (b) words are [animal], the (a) words are (female) and the (b) words are [neuter]. The (a) and (b) words are [animal], the (a) words are (female), and the (b) words are (farm). "There is a direct link between healing the individual and healing this planet. We will not have healthy individuals, healthy families, and healthy communities if we do not have clean air, clean water and healthy soil. Itis our core business to minimally impact the environment and to provide an optimum health[y] and safe environment for our workers and our patients."LloydDean, President and CEO of Catholic Healthcare WestAlthough a key mission of the healthcare sector is to improve peoples health, medical activities contribute to pollute the environment and cause climate change to get worse. This adversely affects human health and imposes additional burdens on the healthcare system. Therefore, it is the sole responsibility of large, profitable healthcare providers to take actions to slow down climate change.RequiredCritically explore the ideas expressed above. Maria downloads an unknown number of apps on her tablet in the month of June Suppose a researcher wishes to edit a gene of interest containing the target DNA sequence 5'_GCGTAACTAGTCCTAACGAG-3' . Design the customized portion of an sgRNA for this target DNA sequence: 5' CUCGUUAGGACUAGUUAGCG Find the slope of the tangent to the curve at the given pointUse the limit function(x) = 3x^2 + 4x 5 at(2,15) A dolphin is performing in a show at an oceanic park and makes a leap out of the water. The dolphin leaves the water traveling at a speed of 82 feet per second and at an angle of 48 with the surface of the water. a. Write a set of parametric equations for the dolphin's motion. b. When does the dolphin dive back into the water? Show work. c. The park is setting up a line of seats to span the entire lump from the moment the dolphin exits the water until he dives back into the water. How long should that line of seats ben Show work. d. How much time into the jump is the dolphin 200 feet from its starting point? Show work. e. Fireworks are set to go off when the dolphin is as high as he can go! How soon after the dolphin leaves the water should the fireworks go off? Show work. f. The trainers want to build a wall for the dolphin to jump over before he reaches his highest point. The original plans called for the wall to be 30 feet tall. Should the dolphin be able to clear the wall? Explain. g. If your answer to part fis yes, approximately how far away from the dolphin's starting point should the wall be placed to ensure that the dolphin clears it, assuming that the trainers want the dolphin to jump over the wall before he reaches his highest point? Explain. A rectangular prism with a volume of 5x^3 +14x^2+8x cubic units has a base area of x^2 + 2x square units. Find the height of the rectangular prism