The mechanism in which the end product of a metabolic pathway inhibits an earlier step in the pathway is most precisely described as.

Answers

Answer 1
B. Feedback Inhabitation

Related Questions

High blood pressure occurs when there is too much blood flowing through the blood vessels at one time. By changing the amount of water in the blood, blood pressure can change. The excretory system can help to lower blood pressure.

Which would most likely occur in the kidney?

A.More water would be transferred from the nephron.
B.Less water would be absorbed into the nephron.
C.The amount of water in the bladder would decrease.
D.The amount of water in the blood would increase.

Answers

Answer:

D

Explanation:

Answer:

A

Explanation:

I took the test. And I pay attention. Truuuuust meeeeee. But, if you so happen to have unfortunetly got it wrong. Tell me, so I can proceed to help others widely across the platform.

The diagram above illustrates the carbon cycle. Which of the Following components of the diagram represent carbon sinks?
A. marine photosynthesis and respiration
B. volcanoes and soil carbon
C. oceans and fossil carbon
D. factories and photosynthesis

The diagram above illustrates the carbon cycle. Which of the Following components of the diagram represent

Answers

Answer:

D) Factories and Photosynthesis

Which of the four factors that affect evolution apply to the finches that the Grants studied? Use
evidence from your research to support your answer. (15 points)

Answers

Answer:

Natural Selection in Real Time

"When we made the comparison between the size of the offspring generation and the population before selection, we found a measured, evolutionary response had taken place and it was almost identical to what we had predicted."

-Peter Grant

Darwin thought that evolution took place over hundreds or thousands of years and was impossible to witness in a human lifetime. Peter and Rosemary Grant have seen evolution happen over the course of just two years.

The Grants study the evolution of Darwin's finches on the Galapagos Islands. The birds have been named for Darwin, in part, because he later theorized that the 13 distinct species were all descendants of a common ancestor. Each species eats a different type of food and has unique characteristics developed through evolution. For example, the cactus finch has a long beak that reaches into blossoms, the ground finch has a short beak adapted for eating seeds buried under the soil, and the tree finch has a parrot-shaped beak suited for stripping bark to find insects.

The Grants have focused their research on the medium ground finch, Geospiza fortis, on the small island of Daphne Major. Daphne Major serves as an ideal site for research because the finches have few predators or competitors. (The only other finch on the island is the cactus finch.) The major factor influencing survival of the medium ground finch is the weather, and thus the availability of food. The medium ground finch has a stubby beak and eats mostly seeds. Medium ground finches are variable in size and shape, which makes them a good subject for a study of evolution.

The first event that the Grants saw affect the food supply was a drought that occurred in 1977. For 551 days the islands received no rain. Plants withered and finches grew hungry. The tiny seeds the medium ground finches were accustomed to eating grew scarce. Medium ground finches with larger beaks could take advantage of alternate food sources because they could crack open larger seeds. The smaller-beaked birds couldn't do this, so they died of starvation.

In 1978 the Grants returned to Daphne Major to document the effect of the drought on the next generation of medium ground finches. They measured the offspring and compared their beak size to that of the previous (pre-drought) generations. They found the offsprings' beaks to be 3 to 4% larger than their grandparents'. The Grants had documented natural selection in action.

While beak size is clearly related to feeding strategies, it is also related to reproduction. Female finches tend to mate with males that have the same size beaks. These factors together can add to the development of new species.

The Grants return each year to Daphne Major to observe and measure finches. They have been collecting data on the finches for over 25 years and have witnessed natural selection operating in different ways under different circumstances.

Why are organisms classified into kingdoms, phylum, class, order, family, genus, and species?

Why are organisms classified into kingdoms, phylum, class, order, family, genus, and species?

Answers

to identify organisms and determine how groups are related

Now explain your diagnosis. Start your argument by writing something like this:

“My group believes that Elisa has/does not have ___. I think that she does/does not have the ___ condition because . . .”

(Then, explain how molecules move through the body when someone has the condition you investigated, and compare that to Elisa’s test results.)

Answers

Answer:

you can use this syntax to answer your q

Explanation:

"My group is convinced that Elisa has a particular illness. Based on her symptoms and test findings, I believe she has the illness because the molecules of the particular drug we have been looking into are not flowing through her body as they should. Elevated quantities of this drug were found in her test results, which is a certain sign of this illness. Additionally, she exhibits symptoms that are characteristic of patients who have this illness."

what is the movement of molecules across a barrier such as the semi-permeable cell membrane called

Answers

Answer:

DIFFUSION

Explanation:

Water, carbon dioxide, and oxygen are among the few simple molecules that can cross the cell membrane by diffusion (or a type of diffusion known as osmosis ). Diffusion is one principle method of movement of substances within cells, as well as the method for essential small molecules to cross the cell membrane.

how do yeast reproduce
A. sexually by producing spores
B. asexually by producing spores
C. sexually through binary fission
D. asexually through binary fission​

Answers

Answer:

B

Explanation:

Thanks hope it helped

What type of mutation has occurred in the following example?
A.) deletion mutation
B.) germ-cell mutation
C.) insertion mutation

Use the screenshot to answer this question. Which letter choice is correct? A, B, or C?

What type of mutation has occurred in the following example?A.) deletion mutationB.) germ-cell mutationC.)

Answers

The type of mutation that has occurred in the example is insertion mutation. So the correct option is C.

What is a insertion mutation?

This type of mutation is one that will involve the addition of nucleotides in a segment of DNA, they can be either one or a complete part of a chromosome. In the image it can be seen that there is an insertion of "A" in the mutated sequence, which gives us an indication that the mutation that was generated is the insertion one.

This mutation can be dangerous since it can change the encoding of some type of amino acid, thus affecting the formation of a certain protein, which can make it abnormal or useless for its purpose. And if we are lucky, the mutation will not occur in an exon, which will not alter the coding of amino acids.

Therefore, we can confirm that the correct option is C. insertion mutation.

To learn more about insertion mutation visit: https://brainly.com/question/10361716

#SPJ1

Whale
Frog
Horse
Lion
Human
Bat
Bird
R
1. The image above represents an example of what type of homologies?
a. Vertebrate homology
b. Molecular homology
C. Biogeographical homology
d. Anatomical homology

WhaleFrogHorseLionHumanBatBirdR1. The image above represents an example of what type of homologies?a.

Answers

Answer:

D. Anatomical homology

Explanation:

Anatomical homology is the similarity between organisms

active aerobics and active recreation are especially good at building cardiovascular endurance (true or false)

Answers

Active leisure and aerobic exercise are particularly effective at enhancing cardiovascular endurance. This statement is true.

Active aerobics and active recreation are excellent ways to improve cardiovascular endurance. These types of exercises involve continuous, rhythmic movements that elevate the heart rate and increase oxygen consumption, which over time can improve the heart's efficiency and strengthen the cardiovascular system.

Regular aerobic exercise has many health benefits, including reducing the risk of heart disease, stroke, and diabetes, as well as improving overall fitness levels and mental well-being. Additionally, it can lead to better weight management and improved sleep quality.

It's important to note that other factors such as diet, genetics, and overall health can impact cardiovascular endurance. It's always recommended to consult with a healthcare professional before beginning a new exercise program, especially if there are any pre-existing medical conditions.

To learn more about aerobic exercise

https://brainly.com/question/29796085

#SPJ4

Which is one source that scientists use to

reconstruct past climate conditions?

fossils frozen in glaciers
daily temperatures

the tilt of Earth's axis

running water

Answers

Answer:

fossils frozen in glaciers.

Explanation:

Hope it helps.

Answer:

fossils frozen in glaciers

Explanation:

Central Dogma Problem Solving. In the given strand, do the transcription and then translation to determine the polypeptide product, or if there is no product. Note: the starting codon is AUG for Methionine (Met). (5 points each, 10 points total) a. 3'ATGCTGCAAGCGTCGGATGAGCTAGACTGCAGTCGATGACCGAGCCGTAGCTAGS
b. 3'GCAACGATGGGTACCACGTGGACTGAGGACTCCTCACTTAGS

Answers

The central dogma is a principle of molecular biology that states that the information present in nucleic acids is converted into the sequence of amino acids of proteins through a process of gene expression.

According to the given problem, the transcription and translation of the given strands will determine the polypeptide product or if there is no product. a) Transcription: 5'-AUG CUG CAA GCG UCG GAU GAG CUA GAC UGC AGU CGA UGA CCG AGC CGU AGC UAG-3'Translation: AUG - Met; CUG - Leu; CAA - Gln; GCG - Ala; UCG - Ser; GAU - Asp; GAG - Glu; CUA - Leu; UGC - Cys; AGU - Ser; CGA - Arg; UGA - Stop. The polypeptide product would be Methionine-Leucine-Glutamine-Alanine-Serine-Aspartic acid-Glutamic acid-Leucine-Cysteine-Serine-Arginine.

b) Transcription: 5'-GCA ACG AUG GGU ACC ACG UGG ACU GAG GAC UCC UCA CUU AG-3'Translation: AUG - Met; GGU - Gly; ACC - Thr; ACG - Thr; UGG - Trp; ACU - Thr; GAG - Glu; GAC - Asp; UCC - Ser; UCA - Ser; CUU - Leu; AG - Stop. The polypeptide product would be Methionine-Glycine-Threonine-Threonine-Tryptophan-Threonine-Glutamic acid-Aspartic acid-Serine-Serine-Leucine-Stop.

To know more about central dogma visit:-

https://brainly.com/question/29546252

#SPJ11

Balance the chemical reaction of water

H2+02 — H20

Added photo plz if you can help

Answers

H2+1/2O2-->H2O

since there are two atoms of hydrogen present in the reactants and in the product you don't need to add any number before H2

we add 1/2 before O2 because only 1 atom is needed for the water molecule

Add 2 molecules of hydrogen peroxide and 2 molecules of water. Since oxygen is naturally diatomic, the total number of atoms of each element is now the same on both sides of the equation so it is balanced.

HELP HELP HELL PLEASE ITS NUMBER 8

HELP HELP HELL PLEASE ITS NUMBER 8

Answers

Answer:

Wetlands are areas where water covers the soil, or is present either at or near the surface of the soil all year or for varying periods of time during the year, including during the growing season. ... Wetlands may support both aquatic and terrestrial species.

I’m pretty sure it’s A. Are not very valuable and so are often filled in.

Turgor, an internal stimulus, refers to ______ in s plant cell.​

Answers

the answer is pressure

Turgor, an internal stimulus, refers to water pressure in plant cell.​

What is Plant cell?

Plant cells are defined as eukaryotic cells that differ from other eukaryotic organisms in several fundamental factors. Plant and animal cells both contain a nucleus with similar organelles. plant cell has the presence of a cell wall outside the cell membrane which is absent in animal cell

Plant cell is rectangular in shape which is comparatively bigger than animal cell. Even though plant and animal cells are eukaryotic and share some cell organelles, they are quite different when compared to animal cells because they perform different functions. There is a stimulus in plant cell called as turgor which is a water pressure.

Thus, Turgor, an internal stimulus, refers to water pressure in plant cell.​

Learn more about Plant cell, here:

https://brainly.com/question/29276890

#SPJ6

A segment of DNA is known to contain the following base sequence:3' GATACCTTTGTGTAGTCATCTT 5'a) Write the mRNA that would be transcribed from this DNA fragment.b) Circle the starter and the stopper in your mRNA sequence. Write the sequence of amino acids which would be encoded in translation. Use the mRNA codon table provided.c) Where in the cell do transcription and translation occur?

A segment of DNA is known to contain the following base sequence:3' GATACCTTTGTGTAGTCATCTT 5'a) Write

Answers

a) In order to transcribe the segment of DNA, it is important to note that this process is important for gene expression as a protein. An enzyme called RNA polymerase moves along the DNA until the end of the gene, releasing the mRNA. The DNA has two strands: one that goes from 5' to 3' direction, and another one that goes from 3' to 5' direction. The one that's used for transcription will always be the 3' to 5' one, so we already have the correct strand to work with, as it is a 3' to 5' strand.

However, the mRNA will be assembled in the 5' to 3' direction. Using the same complementary base-pairing rules as in DNA, we will pair Cytosine (C) with Guanine (G), but as there is no Thymine (T) in RNA, we will pair Adenine (A) with Uracil (U).

Therefore, the sequence o mRNA read in the 5' to 3' direction is:

5' CUAUGGAAACACAUCAGUAGAA 3'

b) The starter codon is the AUG codon of a messenger RNA (mRNA). Therefore, the sequence of amino acids will start to be decoded there.

The stopper codon can be one of the three following options: UAA, UAG or UGA. In this case, we can only find the UAG codon.

The codons, then will be:

AUG GAA ACA CAU CAG UAG

Then, we can say that the amino acids translated will be:

Met Glu Thr His Gln

(Methionine - Glutamine - Threonine - Histidine - Glutamine

c) In eukaryotes, transcription occurs inside the nucleus of the cell and translation occurs in the cytoplasm.

A grove of pine trees grows in a cluster around the bank of a lake. what is this an example of

Answers

Answer: Options are not given, below are the options.

A. Stabilizing effect

B. Intraspecific competition

C. Abiotic factors

D. Interspecific competition.

The correct option is B.

It is intraspecific competition

Explanation:

It is intraspecific competition because the same species of plants are competing for limited available resources.

Intraspecific competition occur between member of the same organism where organism of the same species compete for limited available resources.

A grove of pine trees grows in a cluster around the bank of a lake is an example of intraspecific competition because the pine trees are of the same species and they compete for available limited resources.

List changes that occur in the cell during metaphase.

Answers

The changes that occur during metaphase are highlighted in the section below in detail.

Changes that occur during metaphase

During metaphase, the spindle fibers attach to the centromeres of the chromosomes and align them in the center of the cell, the nuclear envelope breaks down, and microtubules move the chromosomes to opposite poles of the cell.

The centrosomes move to opposite poles of the cell, the kinetochores of the chromosomes attach to the spindle fibers, the chromosomes condense and become visible, and the asters form around the centrosomes.

In conclusion, the chromosomes are at their second-most compacted and coiled state during the mitotic phase of the eukaryotic cell cycle, known as metaphase.

Learn more about metaphase here:

https://brainly.com/question/13627503

#SPJ1

I need help. Write a short paragraph that compares the reproductive structures of gymnosperms and angiosperms

Answers

Answer:

Angiosperms are plants with flowers, gymnosperms are plants that do not have flowers. Both groups belong to spermatophytes or seed plants.Gymnosperms are seed-producing plants that do not possess flowers. In gymnosperms, the flowers are replaced by cones, which lack ovaries.

Explanation:

Which statement about the hormone insulin is correct?

a) It causes body temperature to decrease.
b) It directly helps the body to deal with stress.
c) It acts on the kidney, telling it to absorb more water.
d) It lowers the amount of glucose in the blood.

Answers

Answer:

the true statement is of letter D

Explanation:

the reason why I said is D , this is because the insulin is used to change the excess carbohydrates (glucose) into glucogen which is a complex compound made up of excess glucose in activated in the body , to control the amount of blood sugar in the body. for more information check the biology book called all about our body and check about pancreas

The arrangement of the water molecules in ice causes the ice to float. Explain how ice floating on the surface of a body of water affects the water in a way that is beneficial to the organisms in it.

Answers

Answer:

this enables survival of aquatic life

Explanation:

floating ice lowers temperatures of water at the top while at the bottom the temperature is relatively higher. A property called anomalous expansion of water

Water ice helps life on Earth survive because it floats. During the winter, floating ice builds up on top of lakes and seas when surface temperatures are low enough for water to freeze. This ice layer protects the water below it, keeping it liquid and preserving the life that exists there.

What is the arrangement of water molecules in ice ?

The close proximity of the water molecules when water is in its solid state (ice) prevents it from altering shape. The molecules in ice are rigidly spaced apart from one another and are connected by hydrogen bonds, which form a crystalline lattice. This pattern is very regular.

Since liquid water is a fluid, its molecules are joined together by transient hydrogen bonds to form its structure. In ice, the hydrogen bonds solidify and produce a network of interconnected molecules with hexagonal shapes. Ice floats because it is less thick than liquid water.

Learn more about Water molecules here:

https://brainly.com/question/1313076

#SPJ1

Which macromolecule plays a central role as an energy source?

Answers

Answer:

Carbohydrates

Explanation:

Ex: Glucose (monosaccharide)

What kind of cells does HIV target? How does this targeting affect the hosts body process

Answers

Answer:

The white bloods cells, it takes control of the DNA.

Explanation:

White blood cells. It gets in your dna and damages it.

person who has allergies has a compromised immune system because the body's immune systel
O attacks its healthy cells.
overreacts to an antigen.
steals nutrients from healthy cells.
responds to mutagens.

Answers

Answer: b overreacts to an antigen

Explanation:

which term refers to the fact that the therapist cannot disclose

Answers

answer

i believe it's confidentiality therapist

Draw a diagram of a lake system, labeling the five different zones. Draw examples of the four different types of organisms in the diagram: plankton, nekton, benthos, and decomposers.

Answers

I hope this helps, you should probably make your own

Draw a diagram of a lake system, labeling the five different zones. Draw examples of the four different

in birds and mammals, a vestige of the sinus venosus of the fish heart remains as the sinoatrial node, which serves as a(n) group of answer choices baroreceptor. site of erythropoiesis. inhibitory node. diastole detector. pacemaker. previousnext

Answers

In birds and mammals, the sinoatrial node is a small cluster of specialized cells located in the right atrium of the heart. It is often referred to as the "pacemaker" of the heart because it generates electrical signals. Pacemaker is right answer.

The vestige of the sinus venosus of the fish heart refers to the evolutionary remnants of the fish heart structure that can still be found in birds and mammals in the form of the SA node. The SA node acts as the primary natural pacemaker of the heart, initiating the electrical impulses that regulate the rhythm and rate of the heartbeat. These impulses spread throughout the heart and coordinate the contraction and relaxation of the atria and ventricles, ensuring an efficient and coordinated pumping action of the heart. Other options listed, such as baroreceptor, site of erythropoiesis, inhibitory node, and diastole detector, are not accurate descriptions of the SA node or its function in the heart.

Learn more about “ pacemaker “ visit here;

https://brainly.com/question/30837829

#SPJ4

can
u answer questions 1-3, and write 4-5 sentces for each question
Walid Elkhatib, an Arab American, bought a Dunkin' Donuts franchise in Illinois. Ten years later, Dunkin' Donuts began offering breakfast sandwiches with bacon, ham, or sausage through its franchises.

Answers

The situation presented is that Walid Elkhatib, an Arab American, bought a Dunkin' Donuts franchise in Illinois. This is the central fact mentioned The situation states that Walid Elkhatib, who is an Arab American, purchased a Dunkin' Donuts franchise in Illinois.


The new development introduced is that Dunkin' Donuts began offering breakfast sandwiches with bacon, ham, or sausage through its franchises. This development is related to the breakfast menu expansion states that Dunkin' Donuts started providing breakfast sandwiches with options like bacon, ham, or sausage in its franchises. This information is introduced, highlighting the specific menu expansion.

Walid Elkhatib, an Arab American, purchased a Dunkin' Donuts franchise in Illinois. Dunkin' Donuts began offering breakfast sandwiches with bacon, ham, or sausage through its franchises The given situation includes Walid Elkhatib, an Arab American, who acquired a Dunkin' Donuts franchise in Illinois.

To know more about  presented Visit;

https://brainly.com/question/28233927

#SPJ11

Using the video from Episode 3 on Henry, compare and contrast the difference between, right, left, and biventricular heart failure. Explain why Henry had right-sided heart failure.Also, note that content in this case scenario incorporates topics from Chapters 16, 18, and 19.Requirements:1-2 references to support your responses.

Answers

Right-sided heart failure occurs when the right ventricle of the heart is unable to pump blood efficiently into the pulmonary artery, leading to congestion of blood in the systemic circulation.

In contrast, left-sided heart failure occurs when the left ventricle fails to pump blood efficiently into the systemic circulation, leading to congestion of blood in the pulmonary circulation. Biventricular heart failure occurs when both the left and right ventricles are failing to pump blood efficiently, resulting in both pulmonary and systemic congestion.

In the case of Henry, he had right-sided heart failure due to his chronic obstructive pulmonary disease (COPD). COPD causes chronic hypoxia, which leads to pulmonary hypertension and eventually right-sided heart failure. The increased pulmonary vascular resistance in COPD causes the right ventricle to work harder to pump blood into the lungs, leading to hypertrophy and eventual failure.

Learn more about congestion :

https://brainly.com/question/1035702

#SPJ4

A student is asked to create models of both prokaryotic and eukaryotic cells. They will use materials to represent the cell membrane,
cytoplasm, DNA, and other internal cell structures. Which structures will be modeled in BOTH cell types? Select ALL that apply )
A) DNA
B) nucleus
C) ribosome
D) mitochondria
E) Golgi apparatus

Answers

These two only:
A) DNA
C) ribosome

A) and C)

Trust me :)

Other Questions
he hybridization of carbon in diamond is _________. Enter your answer with no superscripts or subscripts, i.e., ab3. the area of the base of a cone is 100sq. cm and it's height is 6cm. what is its volume Pronoun Number Quick Check 4 of 5Items Item 4 Which sentences contain pronoun shifts? Select the two correct answers.(1 point) I enjoy visiting Chicago, where you can go to Millenium Park. The bird landed on the feeder when it saw the food. When Charlie got on the bus, he could tell it was almost full. Amanda let everyone know that the colorful quilt was hers. The baker was disappointed when they burned the muffin batch. Up there, keeping the beat with his whole body, wailing onthe fiddle, with his eyes half closed, he was listening toeverything, but he was listening to Sonny. He was havinga dialogue with Sonny. He wanted Sonny to leave theshoreline and strike out for the deep water. He wasSonny's witness that deep water and drowning were notthe same thing he had been there, and he knew. And hewanted Sonny to know. He was waiting for Sonny to dothe things on the keys which would let Creole know thatSonny was in the water.Which two actions are compared in the excerpt?OOLeaving the shoreline is compared to having adialogue with a musician.Drowning is compared to watching a musician playan instrument.Swimming is compared to keeping a beat.Playing the piano is compared to going into deepwater. The tallest living man height was 247cm. The shortest living man was 122.8cm. Heights of men had a mean of 175.97cm and a standard deviation of 7.46cm. Which of these men had the height that was more extreme? Since the z score for the tallest man is z= ? And the z score for the shortest man is z=? Who had the most extreme height? The four-digit numeral $3AA1$ is divisible by $9$. What digit does $A$ represent? Find the future value of an investment which you will deposit $3,029 into each year for 39 years which yields 8% interest. Round your answer to the nearest penny (hundredth) Why might a writer use freewriting?O A. To come up with new ideasO B. To help organize a piece of writingO c. To reflect on how a story should endO D. To double-check a finished draft tha adams founded insurance specialists to process medical claims for physicians' practices. she plans to compete on the basis of cost, offering the lowest processing cost per claim in her market area. ms. adams' company sho This table of values represents a linear function.0238614Enter an equation that represents the function defined by this table of values.x Apply Romberg Integration to S [e(-x) + sin(x)]dx until the relative error is less than 0.0001% 4. How do plays express theme differently than poems do?Plays use staging and music to express theme, while poems often rely on characterization and setting.Plays rely on symbolic details and fresh language to express theme, while poems use mostly dialogue and plot.Plays express theme by developing the setting, while poems express theme using characterization.Plays rely on dialogue and plot to express theme, while poems communicate theme using symbolic details and fresh language. fill in the blank question. two capital budgeting approaches that use discounted cash flows are the __________ value method and the __________ of return method. (enter only one word per blank.) HELPPPPP!!!!!!!! URGENT!!! What is an example of how the abolitionist movement began to grow in the 1830s? Select three responses.Most Southern politicians argued to end slavery. Anti-slavery publications were produced. The American Anti-Slavery Society was founded. Petitions demanded that Congress end slavery. Southern states reduced the use of slave laborPLEASE HELP the midterm and final exam grades for a statistics course are provided in the data set below. jaymes, a student in the class, scored 86 on both exams. treat the given data sets as samples. which of jaymes's grades is more unusual, the midterm grade or the final exam grade? explain. use excel to calculate the z-scores. explain three basic requirement of respiration? Pls I need help thank you 3)Ten students from a class participated in a math quiz. The scores obtained bythem were recorded as follows.11, 6, 7, 13, 1, 13, 16, 7, 13, 16Mean :Median :Mode :Range : which statement about fats is accurate? a. fat can be stored in limited amounts. b. excess carbohydrates can be converted into fat. c. fat has half as many calories as protein. d. fat can be converted back into protein. e. fat is used fight bacteria in the small intestine. Historically, there was ________ a central bank in the u.s.