The human vertebral column curves in two places. Which bones are affected by the curve?

Answers

Answer 1

The human vertebral column curves in two places, and the bones affected by these curves are the cervical (neck) and lumbar (lower back) vertebrae.

The vertebral column, also known as the spine or backbone, is made up of a series of individual bones called vertebrae. There are five regions of the vertebral column: cervical, thoracic, lumbar, sacral, and coccygeal. The cervical region consists of seven vertebrae located in the neck area. This region exhibits a forward curve known as cervical lordosis or cervical curve. The lumbar region is found in the lower back and consists of five vertebrae. It has a natural inward curve called lumbar lordosis or lumbar curve. These curves of the vertebral column are important for maintaining balance, stability, and shock absorption. They also help distribute the body's weight evenly and reduce stress on the spinal structures. It's worth noting that the thoracic region, which includes the chest area, naturally curves outward, creating a slight posterior curve called thoracic kyphosis or thoracic curve. However, this curve is not typically considered one of the two primary curves mentioned in the question.

Overall, the two curves that affect the bones of the vertebral column are the cervical curve and the lumbar curve.

To know more about vertebral column click here:
https://brainly.com/question/32383613

#SPJ11


Related Questions

Biological carbon acts on a timescale of ______________ of years.

Answers

Answer: thousands of years

What are 3 characteristics of balanced forces?

Answers

Answer:

easy, hope this helps (/ O>O ) /

Explanation:

Hanging objects. The forces on this hanging crate are equal in size but act in opposite directions. ...

Floating in water. Objects float in water when their weight is balanced by the upthrust from the water. ...

Standing on the ground.

What are 3 characteristics of balanced forces?

During sexual reproduction, gametes fuse to form a zygote. Sometimes when gametes are formed
during meiosis, the chromosomes do not completely separate. When a gamete with an extra
chromosome fuses with another gamete to form a zygote, the result is usually a genetic disorder. This
occurrence is an example of which chromosome process?
A. Deletion
B.duplication
C.inversion
D.crossing over

Answers

i am pretty sure it is duplication:)

What would happen if an ecosystem lacked decomposers?

Answers

The correct option is C; The ecosystem would stop functioning. Dead leaves, insects, and animals would build up everywhere if decomposers did not exist.

Consider how different the world would be! More significantly, decomposers make essential nutrients available to the primary producers of an ecosystem, which are typically plants and algae.

Decomposers break down complex organic components into simpler chemicals like as water and carbon dioxide, as well as simple nitrogen, phosphorus, and calcium compounds. All of these elements are compounds that plants require in order to flourish.

Bacteria, fungus, and some insects are examples of decomposers. If decomposers disappeared from a forest environment, wastes and the remains of dead creatures would accumulate, and producers (plants) would be deprived of nutrients.

Learn more about decomposers

https://brainly.com/question/28896356

#SPJ4

Full Question ;

What would happen if an ecosystem lacked decomposers?

a. There would be more nutrients available to plants

b. There would be more energy available to plants.

c. The ecosystem would stop functioning.

d. There would be more nutrients available to animals.

when the sun ejects its outer layer into space to become a planetary nebula, most likely the
A) Earth will be ejected from the solar system
B) Earth will be destroyed
C) Earth's oceans will freeze solid
D) Earth will experience a runaway greenhouse effect followed by the total loss of its atmosphere

Answers

When the sun ejects its outer layer into space to become a planetary nebula, the most likely outcome for Earth is that it will not be directly affected.

A planetary nebula is formed during the later stages of a star's life when it has exhausted its nuclear fuel and starts to shed its outer layers. As the sun is a relatively small star, the planetary nebula it creates will not extend far beyond its current position. It will not have a significant impact on Earth, which is located much further away.

However, in several billion years, the sun will exhaust its nuclear fuel and will expand into a red giant, swallowing up Mercury and Venus and potentially rendering Earth uninhabitable. But this is a separate process from the formation of a planetary nebula.

Learn more about the planetary nebula here:

brainly.com/question/1162533

#SPJ11

in the muscle, when a residue of glucose is cleaved from glycogen and converted to pyruvate via glycolysis, what is the net atp production?

Answers

In muscle cells, the net ATP production when a residue of glucose is cleaved from glycogen and converted to pyruvate via glycolysis is 3 ATP molecules.

Glycogen is a polysaccharide that stores glucose, and its breakdown into glucose-1-phosphate is the first step in glycogenolysis. The glucose-1-phosphate is then converted to glucose-6-phosphate, which can enter the glycolytic pathway.

Glycolysis is a metabolic process that occurs in the cytoplasm, consisting of ten enzyme-catalyzed reactions. It converts one glucose molecule into two pyruvate molecules, generating energy in the form of ATP and reducing power in the form of NADH. The glycolytic pathway can be divided into two phases: the energy investment phase and the energy payoff phase.

In the energy investment phase, two ATP molecules are consumed for the phosphorylation of glucose and its conversion to fructose-1,6-bisphosphate. In the energy payoff phase, four ATP molecules are produced through substrate-level phosphorylation, and two NADH molecules are generated via the reduction of NAD+.

When glucose is derived from glycogen, the initial energy investment is reduced by one ATP molecule since the glucose-6-phosphate is already phosphorylated. Thus, the net ATP production in this case is 4 ATP produced - 1 ATP invested, resulting in a net gain of 3 ATP molecules for each residue of glucose cleaved from glycogen and converted to pyruvate via glycolysis.

For more such questions on ATP production.

https://brainly.com/question/31521091#

#SPJ11

Why is there limited vegetation in the tundra?

Answers

Answer:

Frigid temperatures, etc.

Explanation

The tundra has very low temperatures and a layer of permafrost over the soil. It has characteristics similar to the desert and it also has a short summer and a long, freezing winter. Therefore, there are not many flora variations that can thrive in that biome.

Answer:

The tundra experiences little rainfall, which makes the soil devoid of nutrients. The soil is permafrost, or permanently frozen. Both of these factors make it difficult for plants to grow in the tundra.

Explanation:

edge 2020

Not all plant cells contain chloroplasts. What is the most likely reason for this?

Answers

Due to that they do not inhabit an area with sunlight.

Some plant cells such as those underground and deep in the ocean receive no sunlight. Chloroplasts use sunlight for photosynthesis, so the organelle would not be able to function making it useless.

Plant cells are defined as eukaryotic cells that are autotrophs and are capable of photosynthesizing. All plant cells do not contain chloroplasts as no sunlight reaches that area.

What is chloroplast?

Chloroplasts are the organelles of the plant cell constituted of the green-colored pigment called chlorophyll. This pigment is crucial for photosynthetic reactions as they capture the solar energy required to convert the reactants.

The plant parts like underground organs (root system) and inner stems lack chloroplast in their cells as no sunlight reaches that area, hence they are of no use in those systems and organs. They are not exposed to sunlight and cannot photosynthesize.

Therefore, all plant cells do not contain chloroplast as they do not undergo photosynthesis reactions.

Learn more about chloroplast, here:

https://brainly.com/question/11136550

#SPJ2

How is modern Earth different from Earth over four billion years ago?
O Constantly bombarded with comets and asteroids
O Little to no oxygen
O High levels of ultraviolet radiation
O Protective atmosphere

Answers

Modern earth has more protective atmosphere.

The growth of Earth's atmosphere over geologic time, or atmospheric evolution. Although the method by which the present atmosphere evolved from past conditions is complex, there is a wealth of indirect evidence for this evolution. The atmospheric composition has changed in the past as a result of chemical reactions with the Earth's crust and, in particular, with biological processes related to life, according to ancient sediments and rocks.The initial atmosphere of Earth was deficient in free oxygen but abundant in methane, ammonia, water vapor, and the noble gas neon. The first biological generation of oxygen by unicellular organisms and its eventual accumulation in the atmosphere most likely occurred hundreds of millions of years apart.

Therefore, option D. is correct.

Learn more about earth atmosphere:

https://brainly.com/question/21605112

#SPJ9

A scientist finds that a sample of matter contains three types of atoms. The sample can be any of the following, except:
A. compound
B. molecule
C. element
D. mixture

Answers

Answer:

D. mixture

Explanation:

because the mixture is not part of an atom

As per the given scenario, the sample can be any of the following, except element. The correct option is C.

What is an element?

A substance that is unable to broken down chemically into smaller molecules.

An element is made up of atoms with the same atomic number, which means that each atom possesses the same count of protons in its nucleus as the other atoms in the element.

A chemical compound is a chemical substance made up of many identical molecules made up of atoms from multiple elements that are held together by chemical bonds.

A molecule made up of only one element's atoms is thus not a compound.

A scientist discovers three types of atoms in a sample of matter. Except for elements, the sample can be any of the compound, molecule or mixture.

Thus, the correct option is C.

For more details regarding elements, visit:

https://brainly.com/question/13025901

#SPJ2

Kendra is studying the energy pyramid shown. Which statement is supported by the energy pyramid?

Answers

A) The ecosystem can support fewer foxes than grasshoppers.

What is energy pyramid?

An energy pyramid is also called ecological pyramid. It is a graphical representation of the energy that are found within the trophic levels of an ecosystem. The largest level of the pyramid is the producers that is present at the bottom and the shortest level is present on the top of the pyramid which is tertiary consumer that have very low in population. This make the structure like a pyramid. We know that the size of the fox is bigger than grasshopper so more energy is needed by the fox which causes fewer foxes can survive in the ecosystem.

So we can conclude that the ecosystem can support fewer foxes than grasshoppers.

Learn more about energy here: https://brainly.com/question/13881533

#SPJ1

Genetic crosses involving a particular type of flower exhibit complete dominance with respect to petal color. Red(R) is dominant to white(r).
Using the punnet square, what is the expected percentage of offspring that will have white flowers from a cross of parent flowers with a genotype of Rr.

Answers

Petal color is completely dominant in genetic crosses with a certain variety of flower. White (r) has a 25% dominance over red (R). B is all crimson Genetic crosses.

How does genetics work?

Pay attention to how it sounds. the research of genes and inheritance. Heredity is the transmission of genetic traits and features from one generation to the next, including eye color and a greater propensity to catch a certain disease.

Does inherited imply genetic?

Hereditary disorders have the ability to be passed down from one person to the next, whereas genetic disorders can either be familial or otherwise, but there is always some gene mutations change in the chromosome. This is the major distinction between the two concepts.

To know more about Genetic visit:

https://brainly.com/question/28980835

#SPJ1

Identify two challenges that plants had to overcome in order to grow taller. 2. ln contrast to moss, vascular plants such as ferns have a dominant sporophyte.

Answers

It is correct that vascular plants, such as ferns, have a dominant sporophyte phase. In the life cycle of ferns, the sporophyte is the larger, more prominent, and longer-lived phase compared to the gametophyte. Two of these challenges are:

1. Structural support: Taller plants require a strong support system to prevent them from collapsing under their own weight. Vascular plants, such as ferns, developed specialized tissues like lignin to provide rigidity and strength, enabling them to grow taller compared to non-vascular plants like moss.
2. Water and nutrient transport: As plants grow taller, they need an efficient system to transport water and nutrients from the roots to the upper parts of the plant. Vascular plants developed specialized transport tissues called xylem and phloem to facilitate this process, allowing them to grow taller than moss, which lacks these tissues.
In contrast to moss, vascular plants like ferns have a dominant sporophyte, which helps them adapt to terrestrial environments and supports their taller growth.

Learn more about vascular plants here ;

https://brainly.com/question/15806378

#SPJ11

Genes located near one another on the same chromosome are often inherited together. These are called ________.

Answers

Answer: Linked Genes

Explanation:

label all the key bones of the skeletal system

Answers

Answer:

SKULL

CERVICAL VERTEBRAE

MANUBRI STERNI

BODY OF THE STERNUM

XIPHOID PROCESS

LUMBAR BERTEBRAE

LILUM SACRUM

COCCYX

PUBIS FEMUR

PATELLA

TARSUS

METARSUS

PHALANGES

ORVITAL CAVITY

NASAL CAVITY

CLAVICLE

SHOULDER BLADE

RIB

HUMERUS

ULNA

RADIUS

CARPUS

METACARPUS

PHALANGES

FIBULA

TIBIA

Am I right?

Which imaging technique is best suited for localizing brain areas, as described in the studies of neural activity

Answers

The imaging technique that is best suited for localizing brain areas involved in neural activity is functional magnetic resonance imaging (fMRI).

fMRI works by detecting changes in blood oxygen levels in different regions of the brain, which are correlated with neuronal activity.

During an fMRI scan, the participant is asked to perform a specific task, such as viewing pictures or solving a puzzle. Changes in blood oxygenation levels are then measured as the participant performs the task, and the resulting data can be used to create an image of the brain that highlights the regions that are most active during the task.

fMRI has several advantages over other imaging techniques for localizing brain activity, such as its high spatial resolution and non-invasiveness.

It can also be used to study a wide range of cognitive processes, from visual perception to decision-making, and can even be used to track changes in brain activity over time.

To know more about fMRI click on below link:

https://brainly.com/question/28644538#

#SPJ11

Why is the sugar-phosphate backbone important?

Answers

Sugar phosphate backbone of a DNA gives it a definite structure and prevents the DNA from collapsing.

The double helix structure of DNA's sugar-phosphate backbone is crucial. DNA's function and structure are related. The capacity of DNA to store and transmit genetic information is greatly influenced by the pairing of the nitrogenous bases that are joined to the sugar-phosphate backbone. The nucleotides in a DNA sequence are joined by an alternating grey-dark grey sugar-phosphate backbone.  This molecule's directionality is determined by its backbone, which is made up of alternating sugar and phosphate groups.

The bases of DNA and RNA may build proteins and be passed on to new cells thanks to the structure of these molecules, which is maintained by the phosphate and sugar groups. As intermediates in the metabolism of carbohydrates, sugar phosphates, which are phosphoric acid esters of monosaccharides, are produced. Ribose phosphate and deoxyribose phosphate, two of these substances, are components of nucleotides and nucleic acids.

To learn more about DNA click here:

https://brainly.com/question/21992450

#SPJ4

HURRY forest ecosystem web project 7th grade with snake spider rabbit grasshopper bear wolf frog deer grass owl berries fungi bird

Answers

Answer: pls see the attached image {hope it makes sense}

HURRY forest ecosystem web project 7th grade with snake spider rabbit grasshopper bear wolf frog deer

the________ is a thin inner surface behind the eyeball and it contains sensory receptors.

Answers

Retina: the light-delicate internal surface of the eye that contains the receptor poles and cones in addition to layers of neurons that start the handling of transduction for vision.

The conjunctiva is a slender layer that covers the internal surface of the eyelid and the white piece of the eyeball (the sclera). Aggravation of the conjunctiva is called conjunctivitis.

Olfactory epithelium lines the top of the nasal depressions, part of the nasal septum, and the predominant (and some of the time stretching out to the center) turbinate bones. The poles and cones in the retina are the tangible receptors for vision. They convert light into electrical driving forces that are eventually communicated to the cerebrum.

To learn more about eyeballs here

https://brainly.com/question/10945999

#SPJ4

In general, plant/animal mutualisms are______flexible in temperate than tropical climates because______temperate climates. a greater likelihood of disrupting mutualisms in
more, invasive species have
more, the physical environment has
less, the physical environment has
less, invasive species have

Answers

In general, plant/animal mutualisms are more flexible in temperate than tropical climates because the physical environment has a greater likelihood of disrupting mutualisms in temperate climates.

Plant/animal mutualisms are cooperative relationships between plants and animals where both species benefit. Examples include pollination, seed dispersal, and symbiotic relationships such as mycorrhizal associations. The flexibility of these mutualisms refers to their ability to adapt and persist under changing environmental conditions.

Temperate climates experience greater seasonal variation, including fluctuations in temperature, precipitation, and resource availability. These variations can disrupt the delicate balance of mutualistic interactions. For example, changes in flowering patterns due to unpredictable weather events can affect pollinators' ability to find nectar and pollen sources, potentially impacting plant reproduction.

Additionally, the physical environment in temperate climates can pose challenges for plant/animal mutualisms. Factors such as extreme cold, frost, and periodic droughts can alter the timing and availability of resources, making it more difficult for mutualistic partners to synchronize their activities.

Invasive species can also have a greater likelihood of disrupting mutualisms in temperate climates. Invasive plants or animals can outcompete native species for resources, disrupt ecological networks, or establish novel mutualistic partnerships that may not be beneficial for native species.

In contrast, tropical climates tend to have more stable and predictable environmental conditions throughout the year. The relatively consistent temperature, abundant rainfall, and high biodiversity in these regions provide a more favorable context for plant/animal mutualisms to develop and persist.

Therefore, due to the greater likelihood of disruptions from environmental variability and invasive species, plant/animal mutualisms are generally considered to be more flexible in temperate climates compared to tropical climates.

learn more about tropical here

https://brainly.com/question/31034027

#SPJ11

Please help I will give brainliest

Please help I will give brainliest

Answers

The endocrine glands in Figure 2 and their corresponding hormones are:

Pituitary gland: ACTH, LH, FSH, Prolactin, Growth hormone, TSH, ADH, OxytocinPineal gland: MelatoninAdrenal gland: Cortisol, Aldosterone, EpinephrineOvary: Estrogen, ProgesteroneTestis: TestosteroneThyroid gland: Thyroid hormoneParathyroid gland: Parathyroid hormone

What are endocrine glands?

Endocrine glands are a type of gland that secretes hormones directly into the bloodstream to regulate various bodily functions. These glands are responsible for producing and releasing hormones that regulate growth and development, metabolism, sexual function, and other important physiological processes.

The endocrine system is made up of several glands, including the pituitary gland, thyroid gland, adrenal glands, pancreas, and gonads (ovaries or testes), among others. Each gland produces a specific set of hormones that are transported by the bloodstream to target organs and tissues throughout the body.

Learn more about endocrine glands at: https://brainly.com/question/1128099

#SPJ1

how is the coin toss model similar to the way in which traits are inherited in living things how is the model different

Answers

Answer:

Comparing and Contrasting How is this coin-toss model similar to the way in which traits are inherited in living things? How is the model different? Like the model, alleles are independent of one another, and inheritance of one allele does not influence the inheritance of another.

Explanation:

Like the model, alleles are separate from one another, and the inheritance of one allele does not affect the inheritance of another.

How does tossing the coins relate to how the gender of offspring is determined?

By throwing a coin to decide whether the father's X or Y chromosome is passed onto his offspring, the gender of the offspring is determined, and a square, for male, XY, and a circle for female, XX, can be illustrated below each of the vertical lines. Anyone pedigree chart can have all male, all female or any ratio in between.

Thus, in such a way both are different.

To learn more about offsprings click here:

https://brainly.com/question/26287597

Wastes and now the remains largely of dead organic matter would accumulate, and the nutrients in the waste and dead organisms would not be released back into the environment. The producers would not have had enough nutrients.

Answers

Organic matter, organic material, or natural organic matter refers to the large source of carbon-based compounds found within natural and engineered, terrestrial, and aquatic environments.

What is Organic matter?

It is matter composed of organic compounds that have come from the feces and remains of organisms such as plants and animals. Organic molecules can also be made by chemical reactions that do not involve life.

Basic structures are created from cellulose, tannin, cutin, and lignin, along with other various proteins, lipids, and carbohydrates. Organic matter is very important in the movement of nutrients in the environment and plays a role in water retention on the surface of the planet.

Organic chemicals make up all living things. When organisms are alive, they emit or excrete organic material into the environment, lose body parts like leaves and roots, and their corpses are decomposed by bacterial and fungi after they die.

Therefore, Organic matter, organic material, or natural organic matter refers to the large source of carbon-based compounds found within natural and engineered, terrestrial, and aquatic environments.

To learn more about Organic matter, refer to the link:

https://brainly.com/question/29232090

#SPJ6

When 10 g of calcium carbonate is decomposed completely then 5.6 g of calcium oxide is formed the mass of carbon dioxide formed is?

Answers

When 10 g of calcium carbonate is decomposed completely and 5.6 g of calcium oxide is formed then the mass of carbon dioxide formed will be 4.4 gram.

Calcium carbonate is the compound with chemical formula CaCO₃. It is used in dietary supplements to provide calcium for the body. Commonly the compound is also known as chalk.

The decomposition of calcium carbonate is represented by the reaction:

                   CaCO₃ → CaO + CO₂

Since the compound is decomposed completely, therefore, according to the law of conservation of mass, the mass of CO₂ produced will be:

CO₂ = 10 g - 5.6 g = 4.4 g.

To know more about calcium carbonate, here

brainly.com/question/14302319

#SPJ4

are chicken wings better than chicken legs.

Answers

Answer:

yes chicken wings are way superior especially if they are barbque wings.

Explanation:

i love them both lol

Give the one chain to the following DNA AATAGGTACCCATGTGCA To write the complementary dna chain. How many nucleotides does this molecule have in total? How many are the bonds that unite nucleotides together?

Answers

Answer:

AATAGGTACCCATGTGCA (original DNA sequence)

TTATCCATGGGTACACGT

Explanation:

Adenine (A) pairs with Thymine (T). Guanine (G) pairs with Cytosine (C). There are 18 nucleotides in this sequence, as seen by the number of base pairs there are. Hydrogen bonds hold together the matching base pairs.

A segment of DNA is known to contain the following base sequence:3' GATACCTTTGTGTAGTCATCTT 5'a) Write the mRNA that would be transcribed from this DNA fragment.b) Circle the starter and the stopper in your mRNA sequence. Write the sequence of amino acids which would be encoded in translation. Use the mRNA codon table provided.c) Where in the cell do transcription and translation occur?

A segment of DNA is known to contain the following base sequence:3' GATACCTTTGTGTAGTCATCTT 5'a) Write

Answers

a) In order to transcribe the segment of DNA, it is important to note that this process is important for gene expression as a protein. An enzyme called RNA polymerase moves along the DNA until the end of the gene, releasing the mRNA. The DNA has two strands: one that goes from 5' to 3' direction, and another one that goes from 3' to 5' direction. The one that's used for transcription will always be the 3' to 5' one, so we already have the correct strand to work with, as it is a 3' to 5' strand.

However, the mRNA will be assembled in the 5' to 3' direction. Using the same complementary base-pairing rules as in DNA, we will pair Cytosine (C) with Guanine (G), but as there is no Thymine (T) in RNA, we will pair Adenine (A) with Uracil (U).

Therefore, the sequence o mRNA read in the 5' to 3' direction is:

5' CUAUGGAAACACAUCAGUAGAA 3'

b) The starter codon is the AUG codon of a messenger RNA (mRNA). Therefore, the sequence of amino acids will start to be decoded there.

The stopper codon can be one of the three following options: UAA, UAG or UGA. In this case, we can only find the UAG codon.

The codons, then will be:

AUG GAA ACA CAU CAG UAG

Then, we can say that the amino acids translated will be:

Met Glu Thr His Gln

(Methionine - Glutamine - Threonine - Histidine - Glutamine

c) In eukaryotes, transcription occurs inside the nucleus of the cell and translation occurs in the cytoplasm.

A Siamese cat has genes that affect it’s fur color. it’s fur color is also affected by temperature which of the following claims is true

Answers

Answer:

A Siamese cat has genes that affect it’s fur color.

Explanation:

A fossil contains 1/16 of the carbon -14 it began with. How old is the fossil?

Answers

Answer:

1/30

................

The initial population of a bacteria colony is observed to be 500 bacteria. The population shows a growth rate of 50% per day, and the carrying capacity of the surrounding is estimated to be 2,000,000 bacteria. To the nearest whole number, find the population of bacteria after 15 days. A 165,822 bacteria B 622,707 bacteria C) 903,430 bacteria 2,000,000 bacteria

Answers

The population, to the nearest whole number, of bacteria after 15 days is approximately 4,769 bacteria, The correct option is E, None of the above.

To find the population of bacteria after 15 days, we can use the formula for exponential growth:

N = N₀ * \((1 + r)^t\)

Where: N = Final population after time t N₀ = Initial population r = Growth rate per time period t = Time period

Given: N₀ = 500 bacteria r = 50% per day (or 0.5) t = 15 days

Plugging in the values, we have:

N = 500 * \((1 + 0.5)^{15\)

Calculating this expression:

N = 500 * \((1.5)^{15\) N

= 500 * 9.537 N

= 4,768.5

Thus, the correct option is E, None of the above.

To learn more about bacteria follow the link:

https://brainly.com/question/15490180

#SPJ4

The question is inappropriate; the correct question is:

The initial population of a bacterial colony is observed to be 500 bacteria. The population shows a growth rate of 50% per day, and the carrying capacity of the surrounding area is estimated to be 2,000,000 bacteria. To the nearest whole number, find the population of bacteria after 15 days.

A.  165,822 bacteria

B.  622,707 bacteria

C.  903,430 bacteria

D.  2,000,000 bacteria

E.  None of the above

Other Questions
Given an array A of N distinct integer elements with the following property: The first k elements (0 < k < N - 1) are in strictly increasing sequence followed by the strictly decreasing sequence. Example: A = {1, 3, 4, 5, 7, 14, 11, 7, 2, -4, -8}. It monotonically increases from 1 to 14, then decreases from 14 to -8 Implement a sub-linear (O(logN)) running time complexity program in Java that, given an array with the previous property, determines whether a given integer is in the array. Important Notes: You must add the main method in your program in order to test your implementation. There are no data errors that need to be checked as all the data will be assumed correct. You can use the array of the previous example to test your program, however, I suggest that you also use other input arrays to validate the correctness and efficiency of your solution. Your program MUST be submitted only in source code form (.java file). A program that does not compile or does not run loses all correctness points. Who can and cannot pass laws and create legislation in the untitled states Which of these is a true statement about anthropologists?a) Anthropologists' studies are limited to today's cultures and societies. b) Anthropologists study how ancient cultures are similar and different. c) Anthropologists leave the study of human origins to archaeologists d) Anthropologists leave the study of social behaviors to sociologists. is cross contamination of lactose/dairy a real thing? Easy question: Describe a beautiful place.ContentCommunication is convincing and compellingTone, style and register are assuredly matched to purpose and audience Extensive and ambitious vocabulary with sustained crafting of linguistic devicesCompelling, Convincing CommunicationOrganisation. Varied and inventive use of structural features Writing is compelling, incorporating a range of convincing and complex ideas Fluently linked paragraphs with seamlessly integrated discourse markers Uses a public key known to everyone and a private key known only to the recipient. a. Asymmetric encryption b. Symmetric encryption c. Secret key encryption d. Remote key encryption We know that Dickinson chose the word "sense" to mean "sanity."True or FalseMuch Madness is divinest SenseTo a discerning EyeMuch Sensethe starkest MadnessTis the MajorityIn this, as All, prevailAssentand you are saneDemuryoure straightway dangerousAnd handled with a Chain ) Find the sum to infinity of the sequence 1, 1/4, 1/16, 1/64. ( 30 points ) help againnn ! When a light wave enters a new medium and is refracted, there must be a change in the light wave's (A) color (B) frequency (C) period (D) speedWhen a light wave enters a new medium and is refracted, there must be a change in the light wave's(A) color(B) frequency(C) period(D) speed Question 2.1 [2, 1, 1, 1, 1, 4, 1, 4, 1, 4] Given the probability function P(Y= y)= y-1 15 for y=2,3,4,5,6 a) Find the probability distribution. b) Is this a valid probability distribution? Motivate c In the second half of the sixteenth century, England was torn by civil war. witnessed the overthrow of Elizabeth I by Mary Tudor. experienced persecution of Catholics and the rise of Puritan influence. suffered a major defeat by Spain in 1588. Subjective ageAdults older than 25 tend to have younger subjective ages, and the discrepancy between subjective and chronological age increases over the adult years. Identify a control group for the analysis shown in Figure 3. Justify analyzing SIRT3 protein level in four different cancer cell lines, as shown in Figure 1. Based on Figures 1 and 3, describe the relationship between SIRT3 expression and cytoplasmic ATP levels. Calculate the percent change in cytoplasmic ATP levels by SC+RNA cells compared with SC+plasmid cells. The Russian army was led by weak leaders. In addition, Can someone answer this?:(( I really need it Designing simple androids, integrating their degrees of freedom, and testing them out are all aspects of what industry? a. robotics industry b. additive manufacturing industry c. healthcare industry d. engineering design industry How does Dre respond to his first series of lessons? Why does he believe that Mr. Han is not teaching him kung fu? The Karate Kid from 2010 How can cell phones affect people's behavior?. numerical ages for boundaries between time units on the geologic time scale primarily resulted from the study of ____________, in conjunction with relative age data