Research shows that statement A is true: adoptive children and adolescents is about the earlier adoption occurred, the fewer problems the adoptees had.
Studies have found that children adopted as infants or toddlers tend to have better psychological outcomes and fewer behavioral problems than those adopted later in life. Children adopted after the age of seven, in particular, may struggle with attachment and trust issues, as well as feelings of loss and grief. However, it's important to note that not all adoptees will experience these difficulties and each child's experience is unique. While being adopted may not necessarily impact academic performance, adoptees may face challenges related to identity and belonging that can affect their overall well-being. It's important for adoptive parents to provide a supportive and loving home environment and to seek out resources and support when needed.
Learn more about adolescents here,
https://brainly.com/question/30333026
#SPJ11
The
Choose...
is especially important to China's early history. Winds from the Gobi Desert blow
Choose...
onto the river valley. When the river floods, it then deposits the rich material onto the surrounding plain. Because of this,
Choose...
was made possible in China.
The WIND is especially important to China's early history. Winds from the Gobi Desert blow SEEDS onto the river valley. Because of this, AGRICULTURE was made possible in China.
What is AGRICULTURE?The practice of raising cattle and plants is known as agriculture. The invention of agriculture, which allowed people to raise domesticated animals to produce surpluses of food that allowed people to live in cities, was crucial in the growth of sedentary human civilization.
Agriculture has a long history dating back thousands of years. Beginning at least 105,000 years ago, people began harvesting wild grains, and around 11,500 years ago, they started planting them.
Over 10,000 years ago, people began domesticating sheep, goats, pigs, and cattle. In at least 11 different parts of the world, plants have been grown independently.
Even though 2 billion people still relied on subsistence agriculture in the twentieth century, industrial agriculture based on extensive monoculture grew to dominate agricultural output.
Learn more about AGRICULTURE, here
https://brainly.com/question/12568494
#SPJ1
Identify the theorists who are associated with the positivist-functionalist tradition.
The theorists that are associated with the positivist-functionalist tradition are:
August Comte Émile DurkheimTalcott ParsonsWhat is the positivist-functionalist tradition ?This is the philosophy that is used to describe the scientific evidence that is based upon as the most notable way that people use to understand the way that the society that we live in works.
It is the use of controlled experiments and statistics in the study of the human society. Hence we can say that The theorists that are associated with the positivist-functionalist tradition are:
August Comte Émile DurkheimTalcott ParsonsRead more on positivist-functionalist theorists here: https://brainly.com/question/26203347
#SPJ1
Think of a team that you are on, or have been on recently. How does it stack up against the criteria for quality teamwork? What specific steps could be used to improve the performance of your team? How could TQ techniques be used to improve team processes?
Based on the general criteria for quality teamwork, a team needs to have clear communication, defined roles and responsibilities, shared goals, trust, and respect among team members.
To improve the performance of a team, specific steps could include building a positive team culture, offering constructive feedback, facilitating team-building activities, setting clear expectations, and utilizing effective collaboration tools.
TQ techniques like Lean Six Sigma can help identify areas of inefficiency and streamline team processes to improve productivity and effectiveness.
To know more about positive team culture visit:
https://brainly.com/question/14351310
#SPJ4
what is the three-point system with respect to lighting?
Please answer this in 1-2 sentences please be 100% sure.
Answer:
Humans depend on the environment for basic needs such as food, water, medicine, fuel, materials for shelters, and many other things.
3) In the reading, it is written: Some Congressmen argued during that Congress "should wipe off the stigma under which America labored. "This
brought Jackson again to his feet. He believed, in spite of the fashion of the day, that Negroes were better off as slaves than as freedmen, and that, as the
tax was partial, It would be the most odious tax Congress could impose." What does Jackson mean by his statement?
Jackson's statement that "the blacks were better off as being a slaves than as a freemen and tax should be partial and not being necessary" is what is being referenced.
What is tax?Taxes are compulsory payments made by a government organization, whether local, regional, or federal, to people or businesses.
Tax revenues are used to fund a variety of government initiatives, such as Social Security and Medicare as well as public infrastructure and services like roads and schools.
Taxes are borne by whoever bears the cost of the tax in economics, whether this is the entity being taxed, such as a business, or the final users of the items produced by the business.
Taxes should be taken into consideration from an accounting standpoint, including payroll taxes, federal and state income taxes, and sales taxes.
A government typically taxes its individual and corporate inhabitants to help pay for public works and services as well as to construct and maintain the infrastructure used in a nation.
Learn more about tax, here
https://brainly.com/question/16423331
#SPJ1
Please select the word from the list that best fits the definition
Enjoys learning about other people
Interpersonal
Musical
Body-Kinesthetic
Spatial
Linguistic
Intrapersonal
Logical-Mathematical
Mark this and return
Answer: interpersonal
Explanation: took the test on it
in the past, anthropology has been criticized for failing to properly include the communities being studied in the research process. what practice do anthropologists today frequently use as a response to those critiques? group of answer choices
In the past, anthropology has been criticized for failing to properly include the communities being studied in the research process.
The practice do anthropologists today frequently use as a response to those critiques is elements of polyvocality.
Definition of AnthropologyThe term anthropology comes from the Greek, Anthropos, which means human and logos which means science. Etymologically, anthropology is the study of humans.
Anthropology is a science that studies all human behavior. Starting from evolution, communication behavior, socialization, to adaptation to the environment.
Anthropology is also often regarded as a science that studies the relationship between humans and their culture.
In essence, Anthropology studies five things, namely;
The origin of humans along with their biological development. The occurrence of diversity of physical characteristics of humans. The development and diversity of human culture. The development and spread of various languages in the world. The principles of society based on ethnic groups are scattered all over the world todayLearn more about anthropology at
https://brainly.com/question/14891261
#SPJ4
how does cooperation helps in building our character?
Answer: it involves you making new friends and helping people out
Explanation: with helping people you can build a better character!
human resource management
3. Based on what we learnt about the Principles of Testing, say why it is important to test and select employee's
Testing and selecting employees is an important aspect of human resource management for several reasons:
1. Job Fit: Testing helps assess whether candidates have the necessary knowledge, skills, abilities, and traits required for a specific job. By conducting job-related tests, organizations can determine if candidates possess the qualifications and capabilities needed to perform the job effectively. This ensures that employees are well-suited for their roles, leading to better job performance and productivity.
2. Predicting Performance: Tests provide valuable insights into a candidate's potential job performance. By measuring cognitive abilities, personality traits, or job-specific skills, employers can make more accurate predictions about how well an individual is likely to perform in a particular position. This helps in selecting candidates who have a higher likelihood of success, leading to improved organizational outcomes.
3. Fair and Objective Selection: Testing provides a structured and standardized approach to evaluating candidates. It helps reduce biases and subjectivity in the selection process by focusing on objective measures of qualifications and abilities. This promotes fairness and equal opportunities for all applicants, ensuring that hiring decisions are based on merit rather than personal biases.
4. Cost Reduction: Effective testing and selection processes can help organizations reduce costs associated with hiring and training. By accurately assessing candidates' fit for the job, organizations can make informed decisions, resulting in lower turnover rates and decreased recruitment expenses. Testing also minimizes the risk of hiring underqualified or ill-suited candidates, which can lead to higher employee turnover and additional training costs.
5. Legal Compliance: Testing can assist organizations in ensuring legal compliance in their hiring practices. By using validated and job-related tests, employers can demonstrate that their selection processes are based on legitimate job requirements and not discriminatory factors. This helps organizations adhere to equal employment opportunity laws and regulations, mitigating the risk of legal disputes related to unfair hiring practices.
To read more about Human Resource Management click here
https://brainly.com/question/29871347
#SPJ11
Give reasons why naturalization should or should not be encouraged
Reasons why naturalization should be encouraged,
Big gains to the economy.Economic gains for the native born.Certainty for both immigrants and employers.A stronger, more integrated United States.Forward, not backward, on equality.who were the pharaos
Answer:
The Pharaohs of Ancient Egypt were the supreme leaders of the land. They were like kings or emperors. They ruled both upper and lower Egypt and were both the political and religious leader. The Pharaoh was often thought of as one of the gods.
Explanation:
There you go.
Answer:
:)
Explanation:
the pharaohs were the head of state and religious leaders of ancient Egypt, they were known as the supreme leaders of the land. they ruled both upper and lower Egypt and were both the political and religious leader. Pharaohs were offen coincided with gods.
if court find out that something wrong has been done by someone, the ultimate solution is either to take that person to prison, fine them or ask for compensation. this was a statement by MrMbooli Moses. With this statement in mind, discuss the differences and similarities between Criminal law and Civil law
Mr. Mbooli Moses' speech discusses the crucial differences and similarities between criminal law and civil law. When someone is found guilty of a crime, the appropriate course of action in criminal law is typically to imprison them as punishment for their misbehaviour.
The main topic of discussion is the state's prosecution of the offender for acts that are considered crimes against society. Contrarily, civil law deals with disputes between individuals or groups of persons, and its solutions frequently involve making restitution to the harmed party or paying fines. The affected person is supposed to receive cash compensation or be put back in their original situation. Although all legal systems aim to achieve justice, criminal law lays a greater focus on civil law places more of an emphasis on compensation and dispute resolution than punishment.
learn more about speech here:
https://brainly.com/question/29586134
#SPJ11
PLEASE HURRY
In 1835, a group of Cherokees gave up all their land in Georgia through the Treaty of
O New York
O Indian Springs
O Echota.
O Dahlonega
What is nature’s contribution to the development of Asia?
Answer:
Vast amount of Natural resources.
Explanation:
Natural resources provided a country wit various types of materials that can either be used for creating another products or being sold as raw material to another country. Both of them tend to positively affect that country's economy.
Asian Continent has notoriously immense amount of OIl, words, precious metals, and gas. These resources are extremely crucial in our current system of production. For example, Middle Eastern countries built their entire economy based on one single product: Oil. They collected more than $270 Billion worth of Revenue from that one single product alone.
What does biological determinism theory indicate about criminals?
Biological determinism explanations for criminal behaviour focus to genetic components like skin tone or face structure rather than social or environmental influences.
The idea that a person's behaviour is directly influenced by their genes or some aspect of their physiology, typically at the cost of the environment's involvement in learning or in embryonic development, is known as biological determinism, sometimes known as genetic determinism.
Although the terms "genetic reductionism" and "genetic determinism" are similar, the former refers to the degree of understanding, while the latter refers to the purported causal role of genes. Science and social movements like eugenics, scientific racism, and discussions on the genetic basis of sexual orientation and sociobiology have all been linked to biological determinism.
To know more about Biological determinism visit:
https://brainly.com/question/31622464
#SPJ4
Why is the observed distance of the moving ball less when the observer is on the truck
The observed distance of the moving ball is less when the observer is on the truck because the observer is also moving in the same direction as the ball.
This means that the relative speed of the ball is less, and therefore the observed distance is also less. This is known as the principle of relativity, which states that the laws of physics are the same for all observers in uniform motion relative to one another. In other words, the observed distance of the moving ball is less because the observer on the truck is also moving, and therefore the relative speed of the ball is less.
To know more about Speed:
brainly.com/question/28224010
#SPJ11
Imagine that you are a memory researcher and want to learn about memory errors. You decide to meet with participants and ask them about the time they went camping with their family (even though they have never camped in their lives). At first, the participants are hesitant, not really remembering the camping trip (because it never happened!). However, after you show them a few photoshopped images of them in a sleeping bag and in the forest, they begin to remember details about the trip – how the family went berry picking or that an animal tried to get into the food supply. This phenomenon is referred to as:
either the family went out to harvest berries, or an animal tried to get into the food source. Retrieval practice effect and retrieval-induced forgetfulness are two names for this phenomena.
What is meant by Food Supply?As a result, supply data show the amount of food available for consumption at the retail level rather than the amount of food that is actually consumed. Take note that supply figures do not include consumption-level waste (i.e., that produced at the retail, restaurant, and residential levels).
We can observe that globally over this time, the per capita calorie supply has been steadily rising. The regional variations in these patterns, meanwhile, are substantial.
Learn more about Food Supply, from :
brainly.com/question/2992295
#SPJ1
design a primer that would be good for recognizing the beginning of the following "sequence of interest." describe why your primer is a good one. 3'-acacaggatacgtgctgctcaatgccatgatagccggtcacaagctaatccgattatcgcgcaattcctaaattcgctaaagcgaatcttcaggaaggaaccccgaaggcctttt-5', and so on.
The primer 5'-acacaggatacgtgctgctcaatg-3' is a good choice for recognizing the beginning of the given sequence of interest due to its complementary base pairing, suitable melting temperature, specificity, and avoidance of secondary structures.
A suitable primer for recognizing the beginning of the given "sequence of interest" would be 5'-acacaggatacgtgctgctc-3'.
- The primer sequence is designed to be complementary to the first 20 nucleotides of the given sequence. This ensures a strong binding affinity and specificity.
- The primer starts with a 5' end, allowing it to bind to the 3' end of the template DNA during the PCR amplification process.
- The primer has a balanced GC content, which helps to stabilize the primer-template hybridization and enhance the efficiency of PCR amplification.
- The primer has an appropriate length of 20 nucleotides, which strikes a balance between specificity and stability of primer binding.
- The primer sequence does not contain any self-complementary or repetitive motifs, which could lead to non-specific binding or primer-dimer formation.
- The primer has been designed to avoid regions with potential secondary structures or high GC content, which can hinder primer binding and amplification.
Overall, this primer is a good choice for recognizing the beginning of the given sequence of interest due to its complementarity, balanced GC content, appropriate length, and absence of non-specific binding concerns.
Learn more about primer sequence: https://brainly.com/question/13939729
#SPJ11
The complete question is:
Design a primer that would be good for recognizing the beginning of the following "sequence of interest." Describe why your primer is a good one. 3'-ACACAGGATACGTGCTGCTCAATGCCATGATAGCCGGTCACAAGCTAATCCGATTATCGCGCAATTCCTAAATTCGCTAAAGCGAATCTTCAGGAAGGAACCCCGAAGGCCTTTT - 5', and so on.
Which of the following is a difference between participants in small-N designs compared to large-N designs?
a. Large-N designs only generalize to the population from which participants are drawn, whereas small-N designs generalize to the larger population.
b. Large-N designs benefit from having diverse populations, while small-N designs typically use normative samples.
c. Large-N designs prioritize having a large sample over sampling procedures, while small-N designs focus on sampling procedures.
d.Large-N designs are more concerned with selecting representative participants, while small-N designs focus on unique cases
The main difference between participants in small-N designs and large-N designs lies in their representativeness and focus. The Correct option is D
Large-N designs prioritize selecting representative participants to ensure generalizability to the larger population. The emphasis is on collecting data from a large number of participants to establish patterns and trends that can be applied beyond the sample. In contrast, small-N designs focus on studying unique cases or individuals in-depth, aiming to gain a deep understanding of their specific characteristics and behaviors.
The goal is not to generalize to a larger population but to explore the intricacies of the selected cases. Consequently, large-N designs prioritize representativeness, while small-N designs prioritize uniqueness and detailed examination.
Learn more about Large-N designs
https://brainly.com/question/29643697
#SPJ4
can someone help me on this please im sure you all know it
In the film, Nemo's bond with the anemone is mutually beneficial for both Nemo and his father Marlin. They are protected and housed by the anemone, and in exchange, they clean the anemone by eliminating waste and providing it food.
Nemo's school, and the ecosystem2. A Moorish idol, a yellow tang, and a royal gramma are just a few of the many varieties of animals that go to Nemo's school in the film. It may be difficult for these species to live in harmony in an enclosed area like a fish tank because they have different native habitats and behaviors.
3. The boat scene from Finding Nemo aims to emphasize how human activity affects marine life. It illustrates the threats posed by human activity to marine life, including pollution, fishing nets, and habitat destruction.
4. Because of her short-term memory loss, Dory relies significantly on her instincts throughout the entire film. As an illustration, consider how she automatically moves through a jellyfish forest by imitating the patterns of other fish swimming in and out.
5.The East Australian Current (EAC), which is portrayed in the film, is one of the ocean currents that green sea turtles use to migrate. The idea that sea turtles use ocean currents to facilitate their migration is based on actual behavior seen in these species, even though the film may have exaggerated some details for storytelling reasons.
6. The open ocean and the coral reef are two distinct ecosystems that are seen in the movie. The ecology around coral reefs is home to colorful coral formations, numerous fish species, and other marine life that depends on the reef for food and shelter.
7. The importance of marine life prospering in its natural settings as opposed to being confined to tiny aquariums is emphasized in the film. It inspires audience members to value and cherish marine life in its natural habitat.
8. In real life, clownfish actually act in a protective manner towards their young, just like the fictional Marlin and Nemo. On a flat area near the anemone where they live, clownfish are reported to lay their eggs. The males aggressively fan the eggs to provide air and remove debris or potential dangers, guard the eggs, and assure their security until they hatch.
9. In the movie, the fish in the dentist's tank play a variety of roles in the environment's overall functionality. For the patients of the dentist, the fish offer visual interest and enjoyment, helping to create a relaxing environment.
10. Reduce your use of single use plastics as one action you can do to preserve our oceans healthy. Plastics can end up in the water, causing pollution and harm to marine life, especially if they are not properly disposed of or recycled. By selecting more sustainable options, reusing plastics, and
Learn more on care of the ecosystem here https://brainly.com/question/20117105
#SPJ1
The kingdoms of Mali and Ghana were best known for exporting large quantities of
gold
It is TRUE that the kingdoms of Mali and Ghana were best known for exporting large quantities of gold.
The kingdoms of Mali and Ghana were both known for their vast gold reserves and for exporting large quantities of gold. These kingdoms were located in West Africa, along the Sahel region, which was a major trading route connecting North Africa and the Mediterranean world with West and Sub-Saharan Africa.
Gold was a highly prized commodity in the medieval world, used for currency, trade, and luxury items such as jewelry and ornaments. The Kingdom of Ghana, which emerged around the 6th century, was the first West African empire to control the trans-Saharan trade in gold and salt. It maintained its power and wealth through its control of this lucrative trade, and its kings became known as the "lords of gold."
The Kingdom of Mali, which emerged in the 13th century, succeeded Ghana as the dominant power in West Africa. Under the leadership of its most famous ruler, Mansa Musa, Mali became one of the wealthiest empires in the world, due in large part to its abundant gold resources. Mansa Musa's famous pilgrimage to Mecca in 1324 also helped to spread Mali's wealth and prestige throughout the Muslim world.
To know more about kingdoms of Mali
brainly.com/question/2839003
#SPJ4
Principle of simple living high thinking can help in controlling corruption. Explain
Spam answers are not allowed!
The principle of simple living can help in controlling corruption because
it reduces the tendencies towards covetousnessCovetousness is the desire for that which is not ours. When a person desires for what is not his and is beyond his financial abilities, he resorts to using illegal measures to achieve that. These illegal measures are characterized as corrupt.
Teaching the principle of simple living will help people realize that they can have little means and still be happy. Giving examples to that effect, will make them stay away from acts of corruption.
The principle of simple living stresses hardwork against stealing and cheating. It also shows that high thinking, that is making use of our mental abilities is rewarding. When people know that they can attain all their desires when they put in their best, then the rate of corruption will reduce.
Summarily, the principle of simple living and high thinking can help in controlling corruption because it reduces the spirit of covetousness.
Learn more about simple living here:
https://brainly.com/question/14624533
innate behavior is(1 point) responses learned behavior. learned behavior. conditioned behavior. conditioned behavior. voluntary behavior. voluntary behavior. instinctual behavior.
The correct option is instinctual behavior. Innate behavior refers to behaviors that are naturally present in an organism from birth, without the need for any prior learning or experience. These behaviors are often related to survival, such as hunting, mating, or avoiding predators.
It is genetically programmed and inherited from the organism's parents. It is not something that can be taught or learned, but rather something that is already present in the organism's nervous system. A long answer to your question could delve into the different types of innate behaviors, such as fixed action patterns and reflexes, and how they contribute to an organism's adaptation to its environment.
Innate behavior refers to actions that are inborn, not learned, and are performed automatically in response to specific stimuli. This type of behavior is instinctual, as it is genetically determined and does not require any prior experience or conditioning to be exhibited. Examples of innate behavior include reflexes, fixed action patterns, and certain animal migration patterns.
To know more about experience visit:-
https://brainly.com/question/30841128
#SPJ11
how the American Indian cultures of the Hohokam and those of the Great Plains differed.
Answer:
Hohokam made irrigation canals.
The Great Plains America Indians lived in both sedentary and nomadic life.
Explanation:
The Hohokam are famous for creating irrigation canals. They had the largest and most complex irrigation systems which allowed farmers to adopt the desert to grow crops in the same locations for hundreds of years and create an organized society with prosperity, including several hundred people.
The American Indians in the Great Plains lead their life in a nomadic and sedentary lifestyle. They settled in one place during the spring as they planted crops like corn, squash and beans. They did hunting, fishing, and gathering. Bison, deer, moose and elk, rabbits, and prairie chickens were some of the animals they hunted for food.
the standard of living in Mexico.
Answer:
fun stuffidsi
Explanation:
Answer:
fun
Explanation:
How do anatomical and physiological changes impact digestive pathology presentation? What is the link between digestion and psychology? In this discussion we will explore both concepts, as interest in both managing digestive disorders and psychological presentations represent growing fields.Initial PostRead the introduction, conclusion, and one section regarding a condition that piques your interest in Intestinal epithelial barrier and neuromuscular compartment in health and disease.Focus on the general concepts, as opposed to understanding every word. After completing the reading, answer the following question for your initial post: "How does digestive physiology lead to a specific pathological presentation?" You may choose which digestive pathology you’d like to focus on.Use the assigned article, with appropriate APA citations, to support your position with at least 5-6 sentences to support your case.Reply PostIn your reply post, share what factors you find most surprising, as well as any experiences and questions you have about digestive system physiology and pathology presentation. You may use the assigned article, or other credible references of your own selection to support your follow-up post(s).
Anatomical and physiological changes can have a significant impact on digestive pathology presentation. Digestive pathology refers to disorders or abnormalities in the digestive system, such as inflammatory bowel disease, gastrointestinal ulcers etc.
These pathologies can arise from various factors, including structural abnormalities, immune system dysfunction, or disturbances in the normal functioning of the digestive organs. For example, in the case of inflammatory bowel disease, anatomical changes such as chronic inflammation and damage to the intestinal lining can lead to symptoms like abdominal pain, diarrhea, and rectal bleeding. Physiological changes, such as impaired immune responses or altered gut motility, can further contribute to the progression and severity of the pathology. The link between digestion and psychology is complex and multifaceted. Research has shown that there is a bidirectional relationship between the digestive system and the brain, known as the gut-brain axis. The gut has its own complex network of neurons, called the enteric nervous system, which communicates with the central nervous system. This communication occurs through various pathways, including the release of neurotransmitters and hormonal signals.
learn more about psychology here
https://brainly.com/question/31538247
#SPJ11
True or false: Judaism is monotheistic.
Answer:
True
Explanation:
accoridng to locke, what rights do men possess
The correct answer is All people, according to Locke, are equal because they are born with certain "inalienable" natural rights. That is, rights that were bestowed by God and are inalienable. "Life, liberty, and property," .
One of the most important political thinkers of the modern era was John Locke (1632–1704). He defended the idea that men are essentially free and equal in the Two Treatises of Government against the idea that God had predestined everyone to be subservient to a king. Additionally, as moral behaviour is the highest expression of culture, it is every man's responsibility to always hold it in the highest regard. Section I. Every person has the right to life, liberty, and personal safety. right to liberty, security, and life.
To learn more about Locke click the link below:
brainly.com/question/29804873
#SPJ4
What was thoreau’s initial viewpoint? what was thoreau’s viewpoint at the end of walden?
Thoreau's initial viewpoint at the end of Walden is living life meant experiencing nature. Thoreau's viewpoint at the end of Walden is It changes in a way that he knew he needed to experience more of his current life yet it stayed the same as he new that nature was a big key in all lives.
What is Thoreau's message in Walden?Living simply, independently, and wisely is the main takeaway from Thoreau's Walden. In order to avoid things that make life too complicated, including the trade market and modern labour, he advises people to attempt to live a free and uncommitted lifestyle. He also stresses how crucial it is to interact as directly and closely with nature as you can.
Why did Thoreau finally leave Walden?Thoreau eventually made the decision to make a new life for himself in nature after growing restless and lacking inspiration. Ward claims that the man "wanted to escape out of the rat race of production and commerce."
To know more about end of Walden visit:
https://brainly.com/question/14995440
#SPJ4