Answer:
1. it is releasing antigens to destroy bacteria
Which type of biological molecules often serve as enzymes that speed up chemical reactions?
Answer:
Enzymes are biological molecules (typically proteins) that significantly speed up the rate of virtually all of the chemical reactions that take place within cells.
Explanation:
hope that helps
Explain the difference between repetition and replication.
While replication conducts multiple runs during identical but distinct experimental runs, repetition conducts duplicate runs in succession.
What is a repetition?When you repeat an experiment, you take different measurements. For instance, if I have three temperatures and want to know how they affect seaweed growth, I'll do four repetitions of each treatment, or four culture vessels, in which the seaweed will grow.
What is the purpose of a replication?Replication's goal is to advance theory by testing current theories against fresh data. Ironically, when existing understanding is at its weakest, the value of replication might be at its highest. With conceptual leaps, unexpected observations, and a patchwork of evidence, upwards of in fits and starts.
To know more about replication :
https://brainly.com/question/13685752
#SPJ9
A population of 40 deer are introduced into a wildlife sanctuary. It is estimated that the sanctuary can
sustain up to 600 deer. Absent constraints, the population would grow by 60% per year. Estimate the population
after one year Pi Estimate the population after two years P2 -
The population of deer in the wildlife sanctuary can be estimated using the formula:
P(t) = P(0) * (1 + r)^t
where P(t) is the population after t years, P(0) is the initial population, r is the growth rate per year, and t is the number of years.
In this case, the initial population (P(0)) is 40 deer, the growth rate (r) is 60% per year (0.60), and we need to estimate the population after one year (P1) and two years (P2).
To calculate P1:
P(1) = 40 * (1 + 0.60)^1
P(1) = 40 * (1 + 0.60)
P(1) = 40 * 1.60
P(1) = 64
Therefore, the estimated population after one year is 64 deer.
To calculate P2:
P(2) = 40 * (1 + 0.60)^2
P(2) = 40 * (1 + 0.60)^2
P(2) = 40 * 1.60^2
P(2) = 40 * 2.56
P(2) = 102.4
Therefore, the estimated population after two years is 102.4 deer.
It's important to note that these are estimates and assume that there are no constraints on the population growth. In reality, factors like limited resources, predation, and disease can affect the growth rate and population size.
To know more about population visit:
https://brainly.com/question/15889243
#SPJ11
what event will most likely occur if protein x is inserted into the inner membrane of mitochondria?
Answer:
The proton gradient across the inner membrane will dissipate.
Protein x forms membrane-spanning channels that alter the permeability of the inner membrane, thereby diffusing the proton gradient across the inner membrane.
What is Mitochondria?A mitochondria is defined as an organelle found in the cells of most eukaryotes, such as animals, plants, and fungi. It has a double membrane structure that uses aerobic respiration to generate adenosine triphosphate, which is used throughout the cell as a source of chemical energy.
Functions of mitochondria include oxidative phosphorylation to produce cellular ATP, but they also have important roles in ion homeostasis, in several metabolic pathways, in apoptosis and programmed cell death, and in ROS production and consumption.
When something is inserted into the membrane of the mitochondria some proteins which change the permeability of the membrane by the gradient.
Thus, protein x forms membrane-spanning channels that alter the permeability of the inner membrane, thereby diffusing the proton gradient across the inner membrane.
Learn more about Mitochondria, here:
https://brainly.com/question/29763308
#SPJ2
Which of the following is true about ECT today?
(1 Point)
A.Patients experience severe pain during the shocks.
B.It is applied to both hemispheres of the brain.
C.Doctors prefer to use it first, before trying drug therapy.
D.It brings no discomfort to the patient.
Answer: B. It is applied to both hemispheres of the brain.
Explanation:
ECT or electroconvulsive therapy is the treatment which is given for the treatment of depression, mental depression, suicidal patients, and others. In bilateral process one electrode is applied on the left and other on the right side of the brain. This way both hemispheres get the electrical treatment. Hippocampus and amygdala are two parts of the brain which are targeted in this process. These parts control the memory and emotion.
Which of the following are examples of seed dispersal? Choose three answers that apply.
А.
a wolf picks up burrs on its fur
В.
a crow eats blackberries from a bush
C. a gardener cuts tulips for a bouquet
D
a wave carries a coconut out to sea
Answer:
A, B
Explanation:
The examples of seed dispersal are a wolf picks up burrs on its fur and a crow eats blackberries from a bush. Thus, option A and B are correct.
What is Clumped dispersion?
Clumped dispersion refers to the pattern of arrangement species. When animals follow clumped dispersion, the distance of individual members of the group is minimized, due to their common need to 'clump' toward a certain area such as a hunting ground or watering hole.
Clumped dispersion is usually due to an uneven distribution of nutrients or resources that are in an environment. The dispersion pattern of the population has to do with the type of the population and the distribution in the environment.
The uniform dispersion occurs when the population is evenly spaced, random dispersion is randomly spaced while the clumped dispersion is greatly influenced by the behavior and the resources.
Therefore, The examples of seed dispersal are a wolf picks up burrs on its fur and a crow eats blackberries from a bush. Thus, option A and B are correct.
Learn more about dispersion on:
brainly.com/question/1017929
#SPJ5
PLS HELP TIMED!!!
1. The school district wanted to determine whether the more expensive floor wax (Brand A) was better than the cheaper one (Brand X) at protecting its floor tiles against scratches. One liter of each brand was applied to each of 10 test sections of the cafeteria floor. The test sections were all the same size. Ten (10) other test sections received no wax. After 4 weeks, the number of scratches in each of the test sections was counted.
What is the dependent and independent variable?
- number of tiles
-type of wax
- number of scratches
- number of weeks
What is the control of the experiment?
-floor tiles with no wax
- brand A
-brand X
-there is no control
2. Which type of graph would best represent the number of students whose favorite sport was either basketball, tennis, football, or track:
a. line graph
b. histogram
c. circle graph
d. bar graph
Answer:
1.
Dependant = number of scratches
Independent = type of wax
Control = floor tiles with no wax
2.
D, Bar graph
Explanation:
Hope this helped.
Good luck :)
spinal segmental and supraspinal mechanisms underlying the pain-relieving effects of spinal cord stimulation: an experimental study in a rat model of neuropathy.
The mentioned study investigated the pain-relieving effects of spinal cord stimulation (SCS) in a rat model of neuropathy. The study aimed to understand both the spinal segmental and supraspinal mechanisms underlying these effects.
Here is a general overview of the findings:
Spinal Segmental Mechanisms: Spinal cord stimulation involves the application of electrical impulses to the spinal cord. It was observed that SCS activation produced inhibitory effects on the transmission of pain signals at the spinal level. This segmental mechanism involves the activation of inhibitory interneurons within the spinal cord, which can suppress the transmission of pain signals from peripheral nerves to higher brain centers.
Supraspinal Mechanisms: In addition to the segmental mechanisms, the study explored the supraspinal mechanisms involved in the pain relief induced by SCS. Supraspinal refers to neural processes that occur above the spinal cord, primarily in the brain. The researchers found that SCS activated descending pain modulation pathways originating from the brain, such as the periaqueductal gray (PAG), rostral ventromedial medulla (RVM), and other brain regions. Activation of these supraspinal pathways led to the release of endogenous opioids, which are natural pain-relieving substances. Endogenous opioids act on opioid receptors in the spinal cord, further enhancing the pain-relieving effects of SCS.
Overall, the study demonstrated that SCS exerted its pain-relieving effects through a combination of spinal segmental and supraspinal mechanisms. The segmental mechanisms involved the inhibition of pain signals at the spinal level, while the supraspinal mechanisms involved the activation of descending pain modulation pathways and the release of endogenous opioids.
It is important to note that this summary provides a general understanding of the study's focus and its major findings. For more detailed information and specific experimental methods, it is recommended to refer to the original research article.
learn more about neuropathy here
https://brainly.com/question/30123225
#SPJ11
Question 2
Which of the following is an advantage of asexual reproduction?
o
Asexual reproduction can drive speciation.
B
It allows for rapid repopulation of an ecological niche.
С
Species that reproduce asexually are less prone to extinction.
D
It allows for easy adaptation to changing environmental conditions.
Answer:
It allows for rapid repopulation of an ecological niche.
Explanation:
The advantages of asexual reproduction over sexual reproduction are:
1) Rapid rate of reproduction: Large number of offspring is formed if the environment is favorable; hence they reproduce at a rapid rate. More individuals are formed from a single cell in less time.
2) Better chances of survival: Since large number of offspring are formed they have better chances of survival
3) The offspring produced are exactly identical to parents, so they retain the qualities of the parent cell.
Answer:
B
It allows for rapid repopulation of an ecological niche.
Explanation:
I got it right
Isotopes are atoms of the same element with the same number of protons and ?
Answer:
electrons
Explanation:
Isotopes are atoms of the same element that have a different number of neutrons but the same number of protons and electrons. Having a different number of neutrons only changes the mass number of the atom, but the charge is the same.
Hope this helps!
which is the most basic level of organization in the human body
Answer:
a cell
Explanation:
cells are the most basic unit of life. cells form tissues which form organs which form organ systems which form an organism
Answer:
The first and most basic level of organizations in human body is cellular level. Cell is the basic unit of life and smallest unit.
What Is a non example of a smooth muscle
Answer:
stomach, uterus, and urinary bladder
Explanation:
this is present in the walls of these hallow organs and in the walls of passageways like arteries and vains
An RNA Polymerase Is Transcribing A Segment Of DNA That Contains The Following Sequence: -10 -35 LABEL HERE 5′-AGTCTAGGCACTGAATAACTCTTATATCATCTCACGAAGATAGTACAGTTATGGAT-3′ 3′-TCAGATCCGTGACTTATTGAGAATATAGTAGAGTGCTTCTATCATGTCAATACCTA-5′ A. What Type Of Organism Is This DNA From And What Do We Call The Underlined Region Of DNA? B. What Protein Is Going To
2. An RNA polymerase is transcribing a segment of DNA that contains the following sequence: -10 -35 LABEL HERE 5′-AGTCTAGGCACTGAATAACTCTTATATCATCTCACGAAGATAGTACAGTTATGGAT-3′ 3′-TCAGATCCGTGACTTATTGAGAATATAGTAGAGTGCTTCTATCATGTCAATACCTA-5′ A. What type of organism is this DNA from and what do we call the underlined region of DNA?
B. What protein is going to bind to that underlined regions of DNA?
C. Using your knowledge of the underlined region, label the coding and template strands above.
D. What will be the sequence of the mRNA product if the polymerase is transcribing the bold region of DNA (be sure to label the 5′ and 3′ ends of your RNA molecule)?
A. The type of organism cannot be determined from the given information. The underlined region of DNA is called the promoter region.
B. The protein that is going to bind to the underlined region of DNA is the RNA polymerase.
C. The coding strand is the non-template strand, while the template strand is the one being transcribed by the RNA polymerase.
How to determine the type of organism?A. From the given DNA sequence alone, it is not possible to determine the type of organism the DNA is from. The sequence provided is a generic DNA sequence, and additional information about the organism is required for identification. However, the underlined region of DNA is known as the promoter region. It is located upstream of the transcription start site and plays a crucial role in initiating transcription by providing a binding site for RNA polymerase and transcription factors.
B. The underlined region of DNA serves as the promoter, and the protein that binds to this region is the RNA polymerase. RNA polymerase is an enzyme responsible for synthesizing RNA from a DNA template during transcription. It recognizes and binds to the promoter region, facilitating the initiation of transcription and the synthesis of RNA molecules.
C. In the given sequence, the non-underlined strand (AGTCTAGGCACTGAATAACTCTTATATCATCTCACGAAGATAGTACAGTTATGGAT) is the coding strand, also known as the sense strand. It has the same sequence as the transcribed RNA, except that thymine (T) is replaced by uracil (U) in RNA. The underlined strand (3'-TCAGATCCGTGACTTATTGAGAATATAGTAGAGTGCTTCTATCATGTCAATACCTA-5') is the template strand, also known as the antisense strand. It serves as the template for RNA synthesis during transcription.
D. The mRNA product synthesized by the RNA polymerase from the bold region of DNA will have the same sequence as the template strand, with the thymine (T) replaced by uracil (U). Therefore, the sequence of the mRNA product would be 5'-UCCAUAAUCUUUCGAGAUGAUAU-3' (with the 5' and 3' ends labeled accordingly).
Learn more about Transcription process
brainly.com/question/30020711
#SPJ11
Which is true ?
Both mountains and volcanoes are formed from pockets of magma that rise up during eruptions. However, mountains can grow to be much higher than volcanoes because they also grow from movement by tectonic plates.
Both mountains and volcanoes have the same outward appearance. However, volcanoes are formed by movements of tectonic plates, whereas mountains are formed from pockets of magma that rise up during eruptions.
Both mountains and volcanoes are formed by the same process of movement by tectonic plates. However, volcanoes can grow to be much higher than mountains because they also grow from pockets of magma that rise up during eruptions.
Both mountains and volcanoes have the same outward appearance. However, mountains are formed by movements of tectonic plates, whereas volcanoes are formed from pockets of magma that rise up during eruptions.
Answer:
I think the 1St one is better
in my opinion :)
Answer:
its D
Explanation:
i just did the test
inflammation of the membranes around the brain or spinal cord is called __________.
Inflammation of the membranes around the brain or spinal cord is called meningitis. It can occur in response to an infection caused by bacteria, viruses, fungi or other microorganisms, or due to non-infectious causes such as medication reactions, autoimmune diseases or cancer.
The symptoms of meningitis may include fever, headache, neck stiffness, sensitivity to light, confusion, seizures, and a rash. It can be a life-threatening condition if not treated promptly, especially in cases of bacterial meningitis. The diagnosis is typically made through a combination of physical examination, blood tests, and a lumbar puncture to obtain a sample of cerebrospinal fluid for analysis.
Treatment depends on the underlying cause of the meningitis and may include antibiotics, antiviral medication, or supportive care. In summary, meningitis is a serious condition that requires prompt medical attention and treatment.
To know more about membranes visit:-
https://brainly.com/question/28592241
#SPJ11
activation of a pathway that generates ip3 will: group of answer choices inhibition of mlcp activity, increasing the relative amount of mlck in the cell, leading to contraction. leads to greater influx of na through voltage-gated na channels, increasing contraction. open ip3 channels on sr which releases ca2 , leading to smooth muscle contraction. activation of camp, which inhibits contraction.
The activation of a pathway that generates IP3 results in a cascade of events that: option (C) states "open ip3 channels on sr which releases ca2, lead to smooth muscle contraction".
Activation of a pathway that generates IP3 (inositol trisphosphate) will lead to inhibition of myosin light chain phosphatase (MLCP) activity, increasing the relative amount of myosin light chain kinase (MLCK) in the cell, which ultimately leads to contraction.
The increased MLCK activity leads to a greater influx of sodium (Na+) through voltage-gated Na+ channels, which increases contraction. Activation of the pathway also opens IP3 channels on the sarcoplasmic reticulum (SR) which releases calcium (Ca2+), leading to smooth muscle contraction. In contrast, activation of cyclic adenosine monophosphate (cAMP) actually inhibits contraction.
In summary, the activation of a pathway that generates IP3 results in a cascade of events that lead to smooth muscle contraction. First, the inhibition of MLCP activity increases the relative amount of MLCK in the cell. This causes an increased influx of Na+ through voltage-gated Na+ channels, further leading to contraction.
Opening of IP3 channels on the SR then releases Ca2+ which causes the smooth muscle to contract. However, the activation of cAMP actually inhibits contraction.
To know more about IP3 refer here:
https://brainly.com/question/14516912#
#SPJ11
this type of soil consists largely of partially decomposed organic material associated with bogs and is commonly referred to as peat.
Soils consisting primarily of peat are known as Histosols. Peat forms in wetland conditions where there is a high water table or stagnant water.
It limits the availability of oxygen and slows down the decomposition process.
As a result, organic matter, primarily composed of plant material, accumulates and undergoes partial decomposition to form peat.
Histosols are characterized by their high organic matter content, dark color, spongy texture, and ability to retain moisture.
They are commonly found in bogs, moors, and other wetland environments.
Peat soil is an important natural resource used for horticulture, fuel, and as a carbon sink due to its high organic carbon content.
Read more about Stagnant water.
https://brainly.com/question/33887331
#SPJ11
the theory that says weight is maintained through internal regulatory controls making it difficult to lose weight is called the . multiple choice question. behavior modification theory metabolic weight loss theory set-point theory low-fat and low carbohydrate weight loss
The theory that says weight is maintained through internal regulatory controls making it difficult to lose weight is called the c)set-point theory.So,correct option is c.
Set point theory, in accordance with human body weight, expresses that there is a natural control technique in people that effectively manages weight towards a foreordained set load for each individual. This might happen through guideline of energy consumption (e.g.via expanded or diminished hunger) or energy use (for example by means of diminished digestion or sensations of lethargy).
Set point theory clears up why it is hard for health food nuts for keep up with weight reduction over the long run, as calorie limitation might turn out to be less viable or more challenging to keep up with as administrative systems in the body effectively push the body back towards the set point weight.
Set point theory separates between dynamic pay and uninvolved remuneration. In dynamic pay, an administrative component in the body influences energy consumption or admission. In latent remuneration, a reduction in muscle to fat ratio levels prompts a diminishing in energy pay even without an administrative component as there is less weight to be conveyed. Set point theory places dynamic pay likewise toward inactive compensation.
Hence,correct option is c.
To know more about set-point theory,visit here:
https://brainly.com/question/6647731
#SPJ4
(Complete question) is:
the theory that says weight is maintained through internal regulatory controls making it difficult to lose weight is called the . multiple choice question.
a)behavior modification theory
b)metabolic weight loss theory
c)set-point theory low-fat and
d)low carbohydrate weight loss
How do events of the rock cycle result in geological features at the surface of Earth’s crust?
The crust of the Earth moves slowly and continuously. Massive pressures drive rocks up, tilt, fold, and break them. The lowest strata become so tightly packed when enough silt has collected and settled in one location that solid rock is created.
What is Earth crust?The term "earth's crust" refers to the planet's thin, rocky outer layer, which makes up less than 1% of both its radius and volume. It is the uppermost section of the lithosphere, which is made up of the crust and the uppermost part of the mantle. These particles are separated from their source by erosion and carried to a different area by wind, water, ice, or biological activity.
To know more about Earth-crust, check out:
https://brainly.com/question/1563461
#SPJ1
The bending of which body part involves the working together of parts of the skeletal, muscular, and nervous systems?
Answer:neck
Explanation:
The bending of the neck involves the cranial nerves ,muscles and also vertebral skeletal system
Boyle's - if a balloon has a volume of 2 liters and a pressure of 3 atm, what will be the new pressure if the volume decreases to 1.5 liters?
if the volume of a balloon decreases from 2 liters to 1.5 liters, the pressure inside the balloon will increase. The new pressure inside the balloon when the volume decreases to 1.5 liters is 4 atm.
According to Boyle's law, the pressure and volume of a gas are inversely proportional to each other, as long as the temperature and amount of gas remain constant. Therefore, if the volume of a balloon decreases from 2 liters to 1.5 liters, the pressure inside the balloon will increase. To calculate the new pressure, we can use the equation P1V1 = P2V2, where P1 is the initial pressure, V1 is the initial volume, P2 is the new pressure, and V2 is the new volume. Plugging in the values, we get P2 = (P1 x V1)/V2 = (3 atm x 2 L)/1.5 L = 4 atm. Therefore, the new pressure inside the balloon will be 4 atm.
According to Boyle's Law, the pressure and volume of a gas are inversely proportional, provided the temperature and quantity of gas remain constant. In this case, the initial volume (V1) is 2 liters and the initial pressure (P1) is 3 atm. The final volume (V2) is 1.5 liters. To find the new pressure (P2), use the formula P1*V1 = P2*V2. Plugging in the values: (3 atm)*(2 L) = P2*(1.5 L). To solve for P2, divide both sides by 1.5 L: P2 = (3*2)/1.5. P2 = 4 atm. Therefore, the new pressure when the volume decreases to 1.5 liters is 4 atm.
To learn more about pressure visit;
https://brainly.com/question/30673967
#SPJ11
engineering is
scientists use what to write down their information and numbers
Answer:
engineering is the application of science and math to solve problems
Which property is shared by the cells of all living things?
Answer:
All living organisms (whether they are bacteria, archaea or eukaryote) share several key characteristics, properties or functions: order, sensitivity or response to the environment, reproduction, growth and development, regulation (including homeostasis), energy processing, and evolution with adaptation.
Explanation:
Which microscope is best for a viral researcher to use to find the parts of a virus that can be targeted in making a vaccine
When it comes to finding the parts of a virus that can be targeted in making a vaccine, two types of microscopes are commonly used: electron microscopes & cryo-electron microscopes.
Electron microscopes use beams of electrons instead of light to magnify & visualize the virus particles. They are capable of producing extremely high-resolution images, making them ideal for studying the structure of viruses at the atomic level.
However, electron microscopes require the virus to be placed in a vacuum & may also require the use of heavy metal stains, which can affect the natural structure of the virus.
Cryo-electron microscopes, on the other hand, are a specialized type of electron microscope that uses very low temperatures to freeze the virus particles.
This allows for the visualization of the virus in its native state, without the need for heavy metal stains. Cryo-electron microscopy has revolutionized the field of structural biology, & has been used to study a wide range of viruses, including HIV, Zika, & SARS-CoV-2.
Both electron & cryo-electron microscopes have been used extensively in the development of vaccines against viral diseases.
By studying the structure of the virus particles, researchers can identify specific proteins or other molecular structures that are critical to the virus's ability to infect host cells.
To know more about microscopes-
brainly.com/question/18661784
#SPJ1
In guinea pigs, smooth coat (S) is dominant over rough coat (s). If an SS guinea pig is crossed with an ss guinea pig, what possible outcome of guinea pigs in the offspring would you predict?
Answer: All offspring will be Ss and have smooth coats.
Answer:
All offspring will be Ss and have smooth coats.
Why does a vegetarian leave a smaller ecological footprint than an omnivore? (A) Fewer animals are slaughtered for human consumption. (B) There is an excess of plant biomass in all terrestrial ecosystems. (C) Vegetarians need to ingest less chemical energy than omnivores. (D) Eating meat is an inefficient way of acquiring photosynthetic productivity.
A vegetarian leaves a smaller ecological footprint than an omnivore because Eating meat is an inefficient way of acquiring photosynthetic productivity.
What is an omnivore?Omnivores are creatures that can devour and survive on both plant and animal matter. The minerals and energy from the sources consumed are digested by omnivores, who derive their energy and nourishment from both plant and animal matter. They typically possess the ability to consume food sources like bacteria, fungi, and algae. Omnivores are diverse in their origins and frequently have complex eating habits that they independently acquired. The great variety of different organisms that are classified as omnivores can be grouped into numerous subcategories based on their feeding patterns.
To learn more about omnivore with the help of given link:
https://brainly.com/question/21916997
#SPJ4
mining leads to a reduction in __ because it destroys __ by uprooting forests and demolishing mountainsides
Mining leads to a reduction in biodiversity because it destroys ecosystems by uprooting forests and demolishing mountainsides.
The process of mining involves extracting valuable minerals or ores from the earth's crust. To access these resources, mining operations often involve clear-cutting forests and removing topsoil, leading to the destruction of habitats for many plant and animal species. Additionally, mining activities can lead to soil erosion, pollution of water bodies, and the release of harmful chemicals into the environment. These impacts on biodiversity can have long-term consequences, including the loss of species, disruption of ecosystems, and imbalance in natural food chains. In summary, mining activities contribute to the reduction in biodiversity through the destruction of habitats and ecosystems.For more questions on biodiversity
https://brainly.com/question/11542363
#SPJ8
Immediately after a forest fire, the primary consumers in the area will compete most for which biotic factor?
In a freshly burnt forest, primary consumers will compete for forages with themselves.
Primary consumers are organisms that feed on producers.
When a forest is lost to fire, most of the plants (the producers) are lost.
Thus, primary consumers will compete heavily for the few plants that are left among themselves.
More on competitions can be found here: https://brainly.com/question/1270238?referrer=searchResults
In a freshly burnt forest, primary consumers will compete for forages with themselves.
Who are Primary consumers?
Primary consumers are herbivores, feeding on plants.Caterpillars, insects are examples of primary consumers because they only eat autotrophs (plants). Primary consumers are organisms that feed on producers.When a forest is lost to fire, most of the plants (the producers) are lost. A major energy pathway is eradicated, reducing system productivity and shifting importance to energy supplied by primary producers.
Thus, primary consumers will compete heavily for the few plants that are left among themselves.
Learn more:
brainly.com/question/18512933
Please help me!!!! Describe industrial melanism and the effect it had on peppered moths.
Answer:
The evolution of the peppered moth is an evolutionary instance of directional colour change in the moth population as a consequence of air pollution during the Industrial Revolution. The frequency of dark-coloured moths increased at that time, an example of industrial melanism.
Which of these is digested by protasse
Answer:
C) Amino Acid
Explanation:
Protease breaks down proteins into amino acids