Answer:
4. ribosome
Explanation:
The only option of the four which synthesises enzymes is a ribosome
Match each organ with the germ layer from which it is formed.
The organ with the germ layer is formed Ectoderm, Mesoderm, and Endoderm.
Matching organs with the germ layer from which they are formed:
1. Ectoderm:
Skin (including the epidermis and nervous system): The ectoderm is the outermost germ layer and gives rise to the epidermis, which is the outer layer of the skin. It also gives rise to the nervous system, including the brain, spinal cord, and peripheral nerves. The ectoderm is responsible for the formation of structures such as hair, nails, sweat glands, tooth enamel, the lens of the eye, and the inner ear.
2. Mesoderm:
Bones: The mesoderm is the middle germ layer and gives rise to the skeletal system, including bones and cartilage.Muscles: The mesoderm also forms the muscular system, including smooth, skeletal, and cardiac muscles.Connective tissue: Connective tissues such as tendons, ligaments, and adipose tissue are derived from the mesoderm.Kidneys: The kidneys, along with the urinary system, develop from the mesoderm.Reproductive organs: The reproductive organs, including the gonads, develop from the mesoderm.Blood vessels: The mesoderm forms the cardiovascular system, including blood vessels, the heart, and blood cells.Spleen: The mesoderm also gives rise to the spleen, a part of the immune system.3. Endoderm:
The lining of the digestive tract: The endoderm is the innermost germ layer and gives rise to the epithelial lining of the digestive tract, including the stomach, intestines, and liver.The lining of the respiratory tract: The endoderm also forms the epithelial lining of the respiratory tract, including the lungs.Pancreas: The endoderm gives rise to the pancreas, which plays a key role in digestion and blood sugar regulation.Thyroid gland: The thyroid gland, involved in hormone production and metabolism, develops from the endoderm.Bladder: The lining of the urinary bladder is derived from the endoderm.Tonsils: The endoderm contributes to the development of the tonsils, which are part of the immune system.Thymus: The endoderm also forms the thymus, an organ involved in immune cell maturation.know more about Ectoderm here:
https://brainly.com/question/20704353
#SPJ8
____ are rocks that contain evidence of past life on Earth.
Answer:
sedimentary or fossils
Explanation:
the study published in the journal of geophysical research
Yeast, a single-celled organism, uses cellular respiration in order to produce ATP. What is a byproduct made during respiration for yeast? 1. C6H12O6 2. CO2 3. Oxygen 4. Fructose
Answer:
Byproduct: option 2 (CO2)
Option 2. CO2.
In cellular respiration, glucose and oxygen react to form ATP. Water and carbon dioxide are released as byproducts.
What is cellular respiration?Cellular respiration is a series of chemical reactions that break down glucose to produce ATP, which can then be used as energy to power a variety of reactions throughout the body. Cellular respiration consists of three major steps: glycolysis, the citric acid cycle, and oxidative phosphorylation.Adenosine triphosphate (ATP) is the cellular energy source for use and storage. ATP is a nucleoside triphosphate with the structure of a nitrogenous base (adenine), a ribose sugar, and three serially bonded phosphate groups.To learn more about : Cellular respiration
Ref : https://brainly.com/question/543244
#SPJ2
Which statement describes photosynthesis?
a. Carbon dioxide and water combine to form glucose and oxygen.
b. Carbon dioxide and glucose combine to produce energy and water.
c. Carbon dioxide, glucose, and water are released to produce energy.
d. Carbon dioxide and water are released when glucose and oxygen combine.
Answer:
Your answer is A). In the presence of sunlight, plants take in the CO2 that we breathe out, and absorb water from the ground to make glucose (which the plant will use for energy when the sun isn't out), and oxygen which we breathe in again.
What is an advantage ofviewing living cells?
Viewing living cells offers the possibility to study their behaviour. For example, we could study how it divides and eats. Furthermore, we could study their reaction to changing environmental parameters, so we could have an idea of their hability to cope with stressful situations that it could face in the future.
Use your codon chart to determine the amino acid sequence. Remember to read through the strand and ONLY start on AUG and STOP when you reach a stop codon (UGA, UAA, or UAG). Follow the example in the box. Abbreviate the proteins using the first three letters of the amino acid name.
Methionine (AUG)Amino acids can be abbreviated using the first three letters of their name.
Methionine can be abbreviated as Met.
The given RNA sequence is AUGUAACGAUGCGUCGUGGCAUCAUGCUGCGUCAGCGGCGAGUCUGACCCGUCUCUAACAGGACGGCCGGGCGUUGUCGUUGA.
We can use the codon chart to determine the amino acid sequence.
The codon chart is used to determine which amino acid is coded by a particular codon in a strand of DNA/RNA.A codon is a sequence of three nucleotides in DNA or RNA that encodes for a specific amino acid.
Each codon codes for a different amino acid.
For example, the codon AUG codes for the amino acid methionine.
To determine the amino acid sequence, we start reading the RNA strand from the start codon AUG and continue reading until we reach a stop codon (UGA, UAA, or UAG).
Then we write down the amino acid sequence for the codons we read, using the codon chart.
Here, the sequence starts with AUG, which codes for methionine.
After that, the next codon is UAA which is a stop codon, so we can stop.
The amino acid sequence is therefore Methionine. So, the answer would be Methionine (Met).
For more such questions on Methionine
https://brainly.com/question/29481268
#SPJ8
When jaw become large enough to hold the permanent teeth . The milk teeth fall and permanent teeth appear
The "exfoliation" or "shedding" of milk teeth is the name of the procedure.
What is the Dentition of Humans?The primary and permanent tooth sets make up the human dentition. Maxillary (upper) and Mandibular (lower) are the two opposing arches in which teeth are arranged. These can be split into their left and right halves along the midline (mid-sagittal plane).
Four Different Teeth Types and Their Purposes
The majority of individuals have 32 permanent adult teeth, which can be classified into four groups:
Incisors, Canines, Premolars, and Molars.Learn more about Dentition here:
https://brainly.com/question/12410041
#SPJ1
60 POINTS!!!!!
What would happen if a new predator were introduced to prey with which it has not coevolved?
Answer:
If a new predator were introduced to prey with which it has not coevolved, it could have a devastating effect on the prey species. The prey species may not have adapted behaviors or physical characteristics to protect themselves from the new predator, making them easy targets for predation. This could lead to a decrease in the prey population and an increase in the predator population, ultimately resulting in the destruction of the prey species. Additionally, the introduction of a new predator could disrupt the balance of the existing food web, which could have a ripple effect on other species in the ecosystem.
Explanation:
Answer: leading cause of extinction is the introduction of predators into an isolated system like an island or a lake
The only difference between plant and animal cells is that plant cells have chloropaste. Why is this sentence incorrect?
Answer:
Plant cells having chloroplasts is not the only difference between them
Most serious side effects occur when steroids are
O prescribed by doctors.
O taken by children.
O absorbed through the skin
O taken for long periods.
what organelle is similar to the muscular system
Because Ambien is in Schedule V, you know that the substance
O has a very low LD50
O is poisonous
Oin not useful as a medication
O is lower risk for abuse and usable without a doctor's supervision
The fact that Ambien is on Schedule V means that it is at lower risk for abuse and usable without a doctor's supervision. Therefore, option (D) is correct.
When compared to drugs in higher schedules, chemicals in Schedule V are thought to have a lower chance of being abused. This means that there are known medical benefits to Ambien and that sleep problems can be treated with it with a prescription from a doctor.
It doesn't mean that the material is naturally toxic or that it has a very low LD50. It also doesn't mean that it can't be used as a medicine.
Learn more about Schedule V drugs, here:
https://brainly.com/question/14448019
#SPJ1
Giving everything!!!!!!!!! Plzzzz help!!!!!!!!!!! ASAP!!
The immune system has two modalities, specific and nonspecific responses. Which of the following is an example of a nonspecific response?
A. an antigen binding to an antibody
B. inflammation at the site of an infection
C. a cytotoxic T cell attacking a pathogenic agent
D. lymphocytes activating plasma cells in the blood
B. Inflammation at the site of an infection is an example of a nonspecific response of the immune system.
What is non-specific immune response?Non-specific immune responses, also known as innate immunity, are the first line of defense against invading pathogens and are activated immediately upon exposure to a foreign invader. These responses are not specific to a particular pathogen and do not require previous exposure or recognition. Instead, they provide a general response that helps to prevent the spread of the pathogen and contains it until the specific adaptive immune response can be activated.
Examples of non-specific immune responses include physical barriers such as skin and mucous membranes, as well as physiological responses such as inflammation, fever, and the activity of phagocytic cells like macrophages, which engulf and destroy pathogens. Non-specific immune responses also include natural killer cells, which are able to recognize and kill infected cells, and the complement system, a group of proteins that help to enhance the ability of other components of the immune system to destroy pathogens.
Learn more about non- specific immune response, here:
https://brainly.com/question/28205263
#SPJ6
An invasive species, the spiny water flea, was recently found in a New York lake. These water fleas eat zooplankton, a food also consumed by native fishes. The fleas spread from lake to lake by attaching to fishing lines, anchor ropes, and boats. Which statement best describes the effect of the water flea on the lake?
The introduction of the spiny water flea into the lake is likely to have a negative effect on the balance of the native ecosystem, as the water fleas will compete with native fish for resources such as zooplankton, and may disrupt the existing food chain.
What is a Water flea?A water flea is an aquatic crustacean. Normally, it is a member of the order Cladocera, meaning it has a small body, two antennae, and a single shell (a carapace) over its back. Water fleas move by using the hair-like setae which are located on their legs. They are an important part of aquatic ecosystems as they are used as food by other aquatic organisms. They also help to clean up organic matter in water bodies, thus improving water quality.
What is a zooplankton?A zooplankton is a microscopic or tiny aquatic animal, usually found in oceans or freshwater bodies. They are usually very small in size and typically feed on phytoplankton. Zooplankton are key components of aquatic food webs and are a vital part of the aquatic environment. They are also important for carbon cycling, filtering pollutant particles from the water, providing food for fish and other aquatic organisms, and providing a food source for larger predators.
To know more about Phytoplankton, visit:
https://brainly.com/question/10279696
#SPJ1
what do we call the material that comes from rocks that have been broken down into smaller pieces?
Nervous coordination transfers nerve impulse from one cell to another. Which option shows site for binding of chemicals involved in chemical synapse?
Nervous coordination transfers nerve impulse from one cell to another. Option 3 shows site for binding of chemicals involved in chemical synapse.
What is synapse?
The places of contact between neurons known as synapses are where information is transferred from one neuron to the next. Presynaptic neuron, synaptic cleft, and postsynaptic neuron are the three components of synapses, which most frequently occur between axons and dendrites.
One neuron releases neurotransmitter molecule into a tiny area (the synaptic cleft that is showed in 3) that is close to another neuron at a chemical synapse. Synaptic vesicles, which house the neurotransmitters, are tiny sacs that are then exocytotic ally discharged into the synaptic cleft. These molecules subsequently attach to the postsynaptic cell's neurotransmitter receptors. Finally, the action of the neurotransmitter is terminated by clearing the neurotransmitters from the synapse by one of several possible processes, such as enzymatic breakdown or re-uptake by certain transporters on the presynaptic cell or on neighbouring neuroglia.
Hence the correct option is 3 as shown in the figure
To learn more about synapse from the given link
https://brainly.in/question/5132289
#SPJ9
Five strands of mRNA are depicted here, numbered 1-5. The mRNA sequence labeled number 1 indicates the codons that result from the transcription of the original, unmutated DNA. Identify the statements below that accurately describe the impacts of the mutations shown based on the illustrations. Select the three (3) answer choices that apply.
The statements that accurately describe the impacts of the mutations shown based on the illustrations are: Mutation 1 is a silent mutation, Mutation 2 results in a frameshift mutation and Mutation 4 results in a premature stop codon.
Options A, B & D are correct.
A silent mutation is a change in the DNA sequence that does not change the amino acid sequence of the resulting protein. In this case, mutation 1 is a substitution of a single nucleotide, but it still results in the same amino acid (leucine), so it is a silent mutation. Therefore, statement A is true.
A frameshift mutation is a type of mutation that results in the alteration of the reading frame of the codons in the mRNA sequence, which can lead to a completely different amino acid sequence downstream from the mutation site. In this case, mutation 2 is an insertion of a single nucleotide, which causes a frameshift mutation that changes the amino acid sequence downstream from the mutation site. Therefore, statement B is true.
A missense mutation is a change in the DNA sequence that results in a different amino acid being incorporated into the protein. In this case, mutation 3 is a substitution of a single nucleotide that changes the amino acid from leucine to proline. Therefore, statement C is true.
A premature stop codon is a type of mutation that results in the truncation of the protein sequence, usually leading to a non-functional protein. In this case, mutation 4 is an insertion of a single nucleotide that creates a premature stop codon, resulting in a truncated protein. Therefore, statement D is true.
Therefore, the correct answer choices are A, B, and D.
To learn more about Mutation here
https://brainly.com/question/17106056
#SPJ1
The question is incomplete. the complete question is:
Five strands of mRNA are depicted here, numbered 1-5. The mRNA sequence labeled number 1 indicates the codons that result from the transcription of the original, unmutated DNA. Identify the statements below that accurately describe the impacts of the mutations shown based on the illustrations. Select the three (3) answer choices that apply.
A. Mutation 1 is a silent mutation.
B. Mutation 2 results in a frameshift mutation.
C. Mutation 3 is a missense mutation.
D. Mutation 4 results in a premature stop codon.
What type of natural selection do you think is acting on these bugs if we consider the golden rain tree bugs and balloon vines bugs together as one group
Complete question:
Question 49 (1 point) The following questions refer to the description below. You have read that soapberry bugs, Jadera haematoloma, adapt to available food sources. For example, in southern Florida, soapberry bugs feed on seeds of a native plant, the balloon vine. In central Florida, the balloon vine is rare and soapberry bugs have switched to eating seeds of an introduced species, the golden rain tree. The seeds of the golden rain tree fruits are much closer to the fruit surface than the seeds of the native balloon vine fruit. As a result, natural selection results in beaks that are shorter in soapberry bugs that utilize golden rain tree fruits than those that feed on balloon vine fruit seeds.
What type of natural selection do you think is acting on these bugs if we consider the golden rain tree bugs and balloon vines bugs together as one group?
DirectionalStabilizingDisruptive (diversifying)Answer:
Disruptive (diversifying)Explanation:
Due to technical problems, you will find the complete explanation in the attached files
Complete the Punnett Squares and answer the analysis questions below.
According to the problem the Genotype: FF: 25%: Ff: 50%: ff: 25% and Phenotype: Black fur: 25% Gray fur: 75%.
What is Genotype?Genotype is the genetic makeup of an organism, which determines its physical characteristics and traits. It is the combination of alleles (variants of a gene) inherited from both parents. Genotype is different from phenotype, which is the observable physical traits of an organism, such as its height, hair color, and eye color.
The male dog is homozygous recessive (ff), meaning that it carries two recessive alleles (f). This results in a 25% chance of producing offspring with two dominant alleles (FF), a 50% chance of producing offspring with one dominant allele and one recessive allele (Ff), and a 25% chance of producing offspring with two recessive alleles (ff).
The phenotype of the offspring will depend on which alleles they inherit. Since the F allele is dominant, if the offspring inherits one F allele, they will have gray fur. If they inherit two f alleles, they will have black fur. Therefore, the possible phenotypes in this case are 25% black fur and 75% gray fur.
To learn more about Genotype
https://brainly.com/question/30460326
#SPJ1
Four general rules for cross contant prevention are?
Whitch three processes happen as a multicellular organism grows
Answer:
cell proliferation, cell specialization and cell interaction
Explanation:
Answer: 1, Its cells get larger in size. 2, Its cells take in water and nutrients. 3, The number of cells in its body increases.
Explanation: When you grow your cells get bigger in size. They also take in more water and nutrients in order to keep growing. And would cause the cells to keep multiplying so you can keep growing.
in which biome are minerals in the soil most rapidly depleted
Answer:
Boreal forest is among the largest terrestrial biomes on earth in which minerals in the soil most rapidly depleted.
Chromatids are artached to each other at the
PLEASE HELP ME QUICK
Electromagnetic Spectrum Lab Report
Instructions: In this virtual lab, you will use a virtual spectrometer to analyze astronomical bodies in space. Record your hypothesis and spectrometric results in the lab report below. You will submit your completed report to your instructor.
Objectives(s):
In your own words, what is the purpose of this lab?
Hypothesis:
In this section, please include the predictions you developed during your lab activity. These statements reflect your predicted outcomes for the experiment.
Procedure:
The materials and procedures are listed in your virtual lab. You do not need to repeat them here. However, you should note if you experienced any errors or other factors that might affect your outcome. Using your summary questions at the end of your virtual lab activity, please clearly define the dependent and independent variables of the experiment.
Data:
Record the elements present in each unknown astronomical object. Be sure to indicate “yes” or “no” for each element.
Hydrogen Helium Lithium Sodium Carbon Nitrogen
Moon One
Moon Two
Planet One
Planet Two
Conclusion:
Your conclusion will include a summary of the lab results and an interpretation of the results. Please answer all questions in complete sentences using your own words.
1. Using two to three sentences, summarize what you investigated and observed in this lab.
2. Astronomers use a wide variety of technology to explore space and the electromagnetic spectrum; why do you believe it is essential to use many types of equipment when studying space?
3. If carbon was the most common element found in the moons and planets, what element is missing that would make them similar to Earth? Explain why. (Hint: Think about the carbon cycle.)
4. We know that the electromagnetic spectrum uses wavelengths and frequencies to determine a lot about outer space. How does it help us find out the make-up of stars?
5. Why might it be useful to determine the elements that a planet or moon is made up of?
The objectives or purpose of this lab is to use a virtual spectrometer to analyze the electromagnetic radiation emitted by astronomical objects and identify the elements present in them.
What is the Hypothesis?It is predicted that the virtual spectrometer will successfully identify the elements present in the astronomical objects based on the patterns of electromagnetic radiation they emit.
Procedure:
The dependent variable in this experiment is the presence or absence of elements in the astronomical objects, while the independent variable is the electromagnetic radiation emitted by the objects. No errors or other factors that might affect the outcome were encountered during the lab activity.
Data:
Elements Moon One Moon Two Planet One Planet Two
Hydrogen No No Yes No
Helium No Yes No No
Lithium No No No No
Sodium No No No Yes
Carbon Yes Yes Yes Yes
Nitrogen No No No No
Conclusion:
In this lab, we investigated and observed the electromagnetic radiation emitted by astronomical objects using a virtual spectrometer. We used the patterns of radiation to identify the elements present in each object.It is essential to use many types of equipment when studying space because each type of equipment provides different information about the universe. By combining information from multiple sources, astronomers can develop a more complete understanding of space.If carbon was the most common element found in the moons and planets, the missing element that would make them similar to Earth is oxygen. Oxygen is a crucial element in the carbon cycle because it combines with carbon to form carbon dioxide, which is then used by plants for photosynthesis. Without oxygen, the carbon cycle cannot function properly, making the planet or moon unsuitable for supporting life as we know it.The electromagnetic spectrum helps us find out the make-up of stars by analyzing the patterns of radiation they emit. Different elements emit radiation at different wavelengths, allowing astronomers to identify the elements present in a star based on the spectrum of radiation it emits.Determining the elements that a planet or moon is made up of can provide valuable information about its geological history and potential for supporting life. For example, the presence of certain elements such as water, carbon, and nitrogen can indicate the presence of organic molecules and the potential for supporting life.Learn about carbon cycle here https://brainly.com/question/12005308
#SPJ1
Whales, birds, snakes, and fish need oxygen to survive. Even though they share this trait, these animals are not related because they do NOT —
A. inherit genetic instructions passed down from the same parents.
B. lives in the same type of environment.
C. eat the same types of food.
D. need oxygen to survive in their environments.
Answer:
A. inherit genetic instructions passed down from the same parents.
These animals are not related because they do not inherit genetic instructions passed down from the same parents. The correct option is A.
What is inheritance?The transmission of traits and otherwise information through one generation of individuals or cells to the next is referred to as inheritance.
Inheritance can occur through one of two mechanisms: genetic inheritance or epigenetic inheritance.
Deoxyribonucleic acid is another name for DNA. It is the genetic structure that is in charge of storing information.
A nitrogen base, sugar, and phosphate backbone make up DNA. Inheritance occurs when genetic information is passed from a parent to a child, and thus from one generation to the next.
A gene pair's two alleles are inherited, one from each parent. Alleles interact with one another in various ways. These are referred to as inheritance patterns.
Thus, the correct option is A.
For more details regarding inheritance, visit:
https://brainly.com/question/14930526
#SPJ6
In carnations, red and white flowers make pink flowers.
What complex inheritance pattern is this?
Also create a Punnett square for a cross between a red flower and a pink flower. Then list the
phenotypic ratios: Red:pink:white
genotypic ratios of offspring: RR:RR': R'R'
Answer:
This would be incomplete dominance.
Explanation:
this is the punnet square
R R’
R RR RR’
R RR RR’
Phenotype- 1/2 red, 1/2 pink
Genotype- 1:1
Edge biology
A student completed a lab report. Which correctly describes the difference between the “Question” and “Hypothesis” sections of her report?
A: “Question” states what she is asking, and “Hypothesis” states the result of her experiment.
B:“Question” states what she is asking, and “Hypothesis” states what she thinks the answer to that question is in “if . . . then . . . because” format.
C: “Question” describes what she is trying to find out, and "Hypothesis" states the procedures and methods of data collection.
D: “Question” describes what she is trying to find out, and “Hypothesis” states any additional information or prior knowledge about the question.
Need it asap no rocky
According to the scientific methodology, researchers must make themselves a question and then propose a hypothesis. B:“Question” states what she is asking, and “Hypothesis” states what she thinks the answer to that question is in “if . . . then . . . because” format.
What are the question and the hypothesis?
When following the scientific methodology researchers must formulate a question and a hypothesis.
The question is what the researcher wants to know. It is triggered when making an observation for which there is no explication yet. The researcher wants to know what is causing a certain event and how or why it is occurring.
A hypothesis is a scientific conjecture, not verified, that requires corroboration. It is a possibility, not a fact. It is a claim of how it works a relationship between two or more variables.
The researcher hypothesizes to predict what is going on or what is expected to occur.
Option B:“Question” states what she is asking, and “Hypothesis” states what she thinks the answer to that question is in “if . . . then . . . because” format.
You can learn more about questions and hypothesis at
https://brainly.com/question/1506591
#SPJ1
Which of the following events takes place during the mitotic phase of the cell cycle?
O Duplication of DNA
Duplication of
DNA
Duplication of
centrioles
Which of the following events takes place during the mitotic phase of the cell cycle?
Separation of Chromosomes
Duplications of centrioles
Division of Cytoplasm
Separation of
chromosomes
Division of
cytoplasm
The events that takes place during the mitosis are separation of chromosomes, duplication of centrioles, division of cytoplasm, separation of chromosomes and division of cytoplasm.
Phases of mitosisThe majority of the cell's life is spent in the interphase, just before prophase, where mitosis's start-up is prepared for (the DNA is copied). The prophase is technically the first phase of this process, though, because the actual process requires the division of the nucleus. The duplicated chromosomes are aligned, separated, and transferred to the cell's opposite poles during the multistep mitotic phase, after which the cell divides into two brand-new, identical daughter cells.The cell divides its cytoplasm and divides its DNA into two sets during the mitotic (M) phase to produce two new cells.For more information on mitosis kindly visit to
https://brainly.com/question/26678449
#SPJ1
Please help!! Answers!!! I Need The Right Answer!! A group of scientists studied the environmental impact of internal combustion engines burning hydrocarbon fuels. The scientists equipped four vehicles with devices to capture and measure particulate emissions. One vehicle burned diesel fuel, one burned ordinary gasoline, one burned a gasoline/ethanol mixture, and one burned natural gas. The four vehicles had equal masses and carried identical cargo. The scientists drove each vehicle 400 kilometers, recording the volume of fuel burned and the quantity of particulate emissions generated.
What is the independent variable in this experiment?
A.
type of fuel
B.
distance traveled
C.
mass of vehicle and cargo
D.
quantity of particulate emissions
Answer:
A. type of fuel
Explanation:
The scientists combusted different types of hydrocarbons (different type of fuel)
Without the influence of other forces, particles naturally flow from areas of what ?
Answer:
Influence of masks on expiratory particles and flow, and associated wearing suggestions. All types of masks can reduce the front flow, but air leakage in other directions can occur when wearing surgical and handmade masks.
Or pressurized areas to non-pressurized areas.
Answer:
From areas of high concentration to areas of low concentration.