Identify the cell structure/organelle labelled C in the photo below.

Identify The Cell Structure/organelle Labelled C In The Photo Below.

Answers

Answer 1

The organelle is mitochondria because it is oval in shape and it has cristae- the partial partitions that is the infolding of the inner membrane. It is also present in the animal cell (Cell X) and plant cell (Cell Y).


Related Questions

Below is a DNA template strand that serves as a gene used to create a specific protein. The DNA template is read from LEFT to RIGHT. Please determine the sequence of amino acids for the protein that is produced using this sequence of DNA.
AAATAAGTCGGTCACCTAGTC

Answers

To determine the sequence of amino acids for the protein produced using the given DNA template strand, we need to first transcribe the DNA into messenger RNA (mRNA), and then translate the mRNA into the sequence of amino acids using the genetic code.

Transcription involves copying the DNA template into a complementary sequence of mRNA, where thymine (T) is replaced by uracil (U). So, the mRNA sequence for the given DNA template strand would be:

UUAUUAGACCGAGUGGAUCAG

Using the genetic code, we can then translate the mRNA sequence into the sequence of amino acids that make up the protein. Each codon (a sequence of three nucleotides) in the mRNA sequence codes for a specific amino acid, as specified by the genetic code. The sequence of amino acids corresponding to the mRNA sequence would be:

Phenylalanine - Asparagine - Aspartic acid - Arginine - Valine - Serine

So, the sequence of amino acids for the protein that is produced using the given DNA template strand would be:

Phenylalanine - Asparagine - Aspartic acid - Arginine - Valine - Serine.

To know more about amino acids:

https://brainly.com/question/31442968

#SPJ1

Which scientist is known for famously naming the cell after tiny rooms in a monastery? 1. Bill Nye 2. Robert Hooke 3. Aristotle 4. Theodor Schwann

Answers

Answer:

robert hook

Explanation:

 

What characteristics do viruses share with all lining organisms?
A. Respiration
B. Metabolism
C. Movement
D. Replication

Answers

Answer:

D. Replication.

Explanation:

Hope this helps!

Answer:

D. Replication

Explanation:

Viruses share 2 important traits with living things, they have genetic material, and they can evolve. which means they can replicate and undergo mutation, and have DNA. RNA. and much more.

Can somebody help me please ??

Can somebody help me please ??

Answers

Everyone has different options on books they fancy, while some may like “Ages if innocence” others may not, but what makes a story timeless is the natural dramatics

How do density dependent and density independent factors differ in there effects on population growth. Give some examples of each. Please help

Answers

The difference between density dependent and density independent factors in terms of their effects on population growth and common examples are described below.

What is density dependent and independent factors?

Limiting factors are conditions that limit the growth or abundance of a population of organisms in an ecosystem.

There are two types of limiting factors that can affect population growth and they are as follows:

Density dependent factorDensity independent factor

Density dependent factors are factors that regulate the population growth by mechanisms controlled by the size of the population while density independent factors affect population growth irrespective of size of the population.

Density dependent factors limit the growth of a population as the population increases while density independent factors limit the population growth irrespective of whether there is an increase in population or not.

Examples of density dependent factors are as follows:

PredationCompetitionDisease and parasitesWaste accumulation

Examples of density independent factors are as follows:

Natural disasters e.g. earthquake, flooding

Learn more about limiting factors at: https://brainly.com/question/6996113

#SPJ1

What is a solution's molarity, if its absorbance is 0.4?​

Answers

The molarity is 0.07 M when the absorbance is 0.4

What is Molarity?

Molarity is a unit of concentration that measures the amount of a solute present in a solution in terms of the number of moles of solute per liter of solution. Mathematically, it is defined as the ratio of the number of moles of solute to the volume of the solution in liters:

Molarity (M) = number of moles of solute / volume of solution in liters

In the problem, the plot of absorbance against molarity is attached and the graphed is used to read the molarity when the absorbance is 0.4.

The value from the graph is 0.07 M

complete question is attached

Learn more about molarity at:

https://brainly.com/question/26873446

#SPJ1

What is a solution's molarity, if its absorbance is 0.4?

I need the answer to this question A.Or B.OrC.Or D

I need the answer to this question A.Or B.OrC.Or D

Answers

The term endosymbiosis is when one engulf another as a symbiotic relationship because not either of the two involved organism can live by itself.

Answer - Option A - show the big bacteria ingesting the small one.

Which of the following are a part of the circulatory system? I. Blood II. Lungs III. Heart IV. Blood Vessels A. I, II, III, and IV B. II, III, and IV C. I, III, and IV D. I and IV

Answers

Option A is correct as I, II, III, and IV are all a part of the circulatory

system.

The circulatory system, also known as the cardiovascular system, is a complex network of organs and vessels responsible for transporting blood, oxygen, nutrients, hormones, and other necessary substances to different parts of the body. It also plays an important role in the removal of metabolic waste and carbon dioxide from the body.

I. Blood is a vital component of the circulatory system that flows through the blood vessels and carries oxygen, nutrients, hormones, and other substances to different parts of the body.

II. Lungs are also a part of the circulatory system as they help to oxygenate the blood by allowing oxygen from the air to enter the bloodstream and carbon dioxide to be eliminated from it.

III. Heart is a muscular organ that pumps blood to the entire body. It is the center of the circulatory system and also responsible for regulating blood pressure.

IV. Blood Vessels include arteries, veins, and capillaries. Arteries carry oxygen-rich blood from the heart to the body and veins return oxygen-poor blood to the heart. Capillaries are small, thin-walled vessels where the exchange of oxygen, nutrients, and other substances takes place between the blood and the tissues.(option-a)

For such more questions on circulatory

https://brainly.com/question/946975

#SPJ8

The leucine zipper motif functions to A. mediate the physical association of two polypeptides. B. anchor transcriptional activator proteins to enhancer sequences. C. release leucines from misfolded transcription factors. D. integrate leucines and isoleucines into newly translated transcriptional activators.

Answers

Answer:

Option A (mediate...........polypeptides) would be the appropriate choice.

Explanation:

That's only because the leucine zipper symbol consisting of such a leucine remnant anywhere certain 7th point and has an α helical attachment. Maybe the leucine including its zipper between one protein dimples again from α-helix as well as interdigit this same leucine including its iterator of some other antibody.

Some other possibilities in question are not connected to something like the situation in question So that is the correct approach.

ZIP or the leucine zipper motif is a series that contains periodic repetition of the leucine amino group at every seventh position of the array.

The correct option is:

Option A. mediate the physical association of two polypeptides.

This can be explained as:

ZIP forms the alpha-helical conformation that promotes dimerization and sometimes oligomerisation.

bZip allows protein dimerization by interdigitating two leucine of different helices of different molecules.

Therefore, ZIP moderates the physical linkage of polypeptides.

To learn more about the leucine zipper motif follow the link:

https://brainly.com/question/18893448

6.) The drawing shows Earth's axis and revolution around the Sun.
Based on the drawing above, what season are students in Florida experiencing when Earth is at position #3?
(SC.8.E.5.9.1)
A. Fall
B. Spring
C. Winter
D. Summer

Answers

Answer:

Based on the drawing, when Earth is at position #3, Florida would be experiencing the season of WINTER.

Explanation:

This is because Earth's axis is tilted at an angle of approximately 23.5 degrees, which causes different parts of the planet to receive varying amounts of sunlight throughout the year. When Earth is at position #3 in its revolution around the Sun, the Northern Hemisphere (including Florida) is tilted away from the Sun, causing the region to receive less direct sunlight and experience colder temperatures. This corresponds to the season of winter in the Northern Hemisphere.

Name an organism where 10% of the energy that is passed on would be found?
O A. buzzard
O B. mouse
O C. fox
O d. ladybird

Does anyone knows than answer ? Help me !

Answers

i’m guessing mouse? not really sure

Out of the organisms listed, the one that is likely to have 10% of the energy passed on is the buzzard. Therefore, option (A) is correct.

What is second law of thermodynamics?

In an ecosystem, only about 10% of the energy available at one trophic level is passed on to the next trophic level. This is due to the second law of thermodynamics, which states that energy is lost as it moves through a system.

Out of the organisms listed, the one that is likely to have 10% of the energy passed on is the buzzard (option A). Buzzards are predators that feed on a variety of small animals, including mice, foxes, and ladybirds. As a result, they occupy a higher trophic level in the food chain and receive only a small fraction of the energy that is available at lower trophic levels.

Learn more about second law of thermodynamics, here:

https://brainly.com/question/7206767

#SPJ2

What percentage represents the reduction of elks due to the reintroduction of wolves to Yellowstone?
10 percent
30 percent
45 percent
50 percent

Answers

5%-30% sorry i know this doesn’t help alot

Why is it important for others to believe in science

Answers

Answer:

because science is one of the most important channels of knowledge

Explanation:

because of science you can create a new knowledge, improving education, and increasing the quality of our lives.

I hope it can help.

evolutionary significance of bryophytes

Answers

The bryophytes, which include mosses, liverworts, and hornworts, have significant evolutionary significance in the plant kingdom despite their relatively small size and simple structure, they played a crucial role in the colonization of terrestrial environments and the subsequent evolution of higher plants.

Here are some key evolutionary significance of bryophytes:

Adaptation to land: Bryophytes are considered some of the earliest land plants.

They were the first plants to transition from aquatic to terrestrial habitats, paving the way for the colonization of land by other plant groups.

They developed strategies to overcome challenges such as desiccation, limited nutrients, and anchorage to the soil.

Moisture retention: Bryophytes have adaptations that enable them to retain moisture.

They possess specialized structures, such as rhizoids and mucilage, that help absorb and retain water.

This ability to retain water and survive in relatively dry environments was an important adaptation for the conquest of land.

Soil formation: Bryophytes, especially mosses, contribute to soil formation.

They can grow on bare rocks and soil, where their rhizoids aid in weathering and breaking down substrates.

Their decomposed remains also contribute organic matter to the soil, enriching its fertility.

Habitat creation: Bryophytes provide habitat and microenvironments for other organisms.

Their dense mats or cushions create shelter, moisture, and temperature buffering for a variety of organisms, including insects, small invertebrates, and microorganisms.

They contribute to the overall biodiversity and ecosystem functioning.

Reproductive strategies: Bryophytes have unique reproductive strategies. They produce spores that can disperse and colonize new habitats.

Their reproductive structures, such as gametophores and sporophytes, exhibit various adaptations that allowed for successful reproduction in terrestrial environments.

Ecological indicators: Bryophytes are sensitive to environmental changes, making them valuable ecological indicators.

Their presence, abundance, and diversity can indicate environmental conditions such as air quality, moisture levels, and habitat disturbance.

Monitoring bryophytes can provide insights into the health and integrity of ecosystems.

Overall, bryophytes played a crucial role in the evolution and colonization of land by plants.

Their adaptations, ecological roles, and evolutionary history make them important subjects of study for understanding plant evolution, ecosystem dynamics, and the colonization of terrestrial environments.

For similar questions on bryophytes

https://brainly.com/question/3108164

#SPJ8

The bryophytes, which include mosses, liverworts, and hornworts, have significant evolutionary significance in the plant kingdom despite their relatively small size and simple structure, they played a crucial role in the colonization of terrestrial environments and the subsequent evolution of higher plants.

Here are some key evolutionary significance of bryophytes:

Adaptation to land: Bryophytes are considered some of the earliest land plants.

They were the first plants to transition from aquatic to terrestrial habitats, paving the way for the colonization of land by other plant groups.

They developed strategies to overcome challenges such as desiccation, limited nutrients, and anchorage to the soil.

Moisture retention: Bryophytes have adaptations that enable them to retain moisture.

They possess specialized structures, such as rhizoids and mucilage, that help absorb and retain water.

This ability to retain water and survive in relatively dry environments was an important adaptation for the conquest of land.

Soil formation: Bryophytes, especially mosses, contribute to soil formation.

They can grow on bare rocks and soil, where their rhizoids aid in weathering and breaking down substrates.

Their decomposed remains also contribute organic matter to the soil, enriching its fertility.

Habitat creation: Bryophytes provide habitat and microenvironments for other organisms.

Their dense mats or cushions create shelter, moisture, and temperature buffering for a variety of organisms, including insects, small invertebrates, and microorganisms.

They contribute to the overall biodiversity and ecosystem functioning.

Reproductive strategies: Bryophytes have unique reproductive strategies. They produce spores that can disperse and colonize new habitats.

Their reproductive structures, such as gametophores and sporophytes, exhibit various adaptations that allowed for successful reproduction in terrestrial environments.

Ecological indicators: Bryophytes are sensitive to environmental changes, making them valuable ecological indicators.

Their presence, abundance, and diversity can indicate environmental conditions such as air quality, moisture levels, and habitat disturbance.

Monitoring bryophytes can provide insights into the health and integrity of ecosystems.

Overall, bryophytes played a crucial role in the evolution and colonization of land by plants.

Their adaptations, ecological roles, and evolutionary history make them important subjects of study for understanding plant evolution, ecosystem dynamics, and the colonization of terrestrial environments.

For similar questions on bryophytes

brainly.com/question/3108164

#SPJ8

What do these many different combinations tell you about reproduction by meiosis ?

Answers

The many different combinations produced by meiosis tell us that it is a process that generates genetic diversity in offspring. This genetic diversity arises due to the random assortment of homologous chromosomes during meiosis I and the random segregation of sister chromatids during meiosis II. Additionally, crossing-over, a process where homologous chromosomes exchange genetic material, also contributes to the genetic diversity of the offspring. Therefore, the many different combinations produced by meiosis ensure that each offspring has a unique combination of genetic traits inherited from their parents.

Which of the following is not a property of persistent organic pollutants (POPs)?
a.
They have carbon-based molecular structures.
b.
They do not break down easily in the environment.
c.
They are insoluble in fat.
d.
They are polluting and toxic.

Answers

Answer: C

Explanation:

got a 90 on the quiz but correct if wrong

A bar graph would best represent__________variation.
A. Behavioral
B.Discontinuous

Answers

Answer:

a.

Explanation:

bar graph is a chart that plots data using rectangular bars or columns (called bins) that represent the total amount of observations in the data for that category. Bar charts can be displayed with vertical columns, horizontal bars, comparative bars (multiple bars to show a comparison between values), or stacked bars (bars containing multiple types of information).

A teacher asked her students to transcribe a DNA sequence into a complementary RNA strand. She gave the students the following DNA code: AGC TTA GGC. Which student created the correct RNA strand?

Student 1

CUG AAC UUG

Student 2

AGC UUA GGC

Student 3

TCG AAT CCG

Student 4

UCG AAU CCG



Question 4 options:

a.student 3


b.student 2


c.student 1


d.student 4

Answers

Answer:

student 4 bcoz thymine is replaced by uracil in RNA

Answer:Student 4

Explanation:

why don't all cells have a tail

Answers

Answer:

Explanation:

As microscopes improved, biologists discovered that all kinds of cells have beating tails. They are found not only on free-living “animalcules” and sperm, but also on the cells inside multicellular organisms.

Fimbrias and pili differ in that

Answers

Answer:

Explanation: true

4. Using the image below, determine what type of solution the LYSED cell is in.solutionsolutionsolutionHOHO-Н,0LysedNormalShriveledO a. Not enough information is providedO b. IsotonicO c. HypotonicO d. Hypertonic

4. Using the image below, determine what type of solution the LYSED cell is in.solutionsolutionsolutionHOHO-,0LysedNormalShriveledO

Answers

The image shows a red blood cell in different solution. The first image shows an RBC in a hypotonic solutions. The RBC swell and lyse because of the osmotic movement or referred to as hemolysis. The second image shows a normal RBC in an isotonic solution. There is no net change of water to the RBC. The third image shows a shriveled RBC in a hypertonic solution. The water leak out of the RBC briskly than it enters the cell. It is also called as crenated cell.

Answer - Option C - hypotonic solution

Which of the following would be an example of an R-selected species?

Answers

An example of an R-selected species would be one that produces a large number of progeny with small size. So, the correct option is C.

R-selected species are characterized by their reproductive strategy, which focuses on producing a large number of offspring with relatively small size. These species prioritize quantity over quality when it comes to offspring production.

Option ''Large number of progeny with small size'' represents an example of an R-selected species. These species typically have a high reproductive rate and invest minimal resources in individual offspring. By producing a large number of progeny, they increase the chances of survival and successful reproduction in unpredictable or unstable environments.

In contrast, options A) Small number of progeny with small size and B) Small number of progeny with large size represent strategies more commonly associated with K-selected species. K-selected species prioritize quality over quantity, producing fewer offspring but providing them with greater parental investment and resources, resulting in larger size and higher survival rates.Option D) Large number of progeny with large size is less commonly observed in nature and does not align with the reproductive strategy of either R-selected or K-selected species.

Therefore, the correct option is C.

For more questions on species

https://brainly.com/question/14275326

#SPJ8

Complete Question:

Which of the following would be an example of an R-selected species?

A) Small number of progeny with small sizeB) Small number of progeny with large sizeC) Large number of progeny with small sizeD) Large number of progeny with large size

Why did my systolic BP decrease when I got less sleep?
Shouldn’t my BP increase when getting less sleep ?

Answers

Answer:

The decrease in systolic blood pressure following reduced sleep might be due to a number of factors, including:

1. Dehydration: If you're not drinking enough fluids or if you're losing fluids (through sweating, for example) during the night, your blood volume could be affected, leading to a temporary drop in blood pressure.

2. Fatigue: The stress associated with sleep deprivation could cause your body to produce more adrenaline, which might lead to a temporary drop in blood pressure as your body tries to conserve energy.

3. Parasympathetic activation: Sleep deprivation may cause an increase in the activity of the parasympathetic nervous system, which tends to lower heart rate and blood pressure.

4. Individual variations: Your body's response to sleep deprivation might simply be unique to you. There is considerable variability in how people's blood pressure responds to changes in sleep patterns.

It is important to remember that these explanations are general and speculative. If you have concerns about your blood pressure or the effects of your sleep patterns, it is important to consult a healthcare professional for personalized advice.

Where is this phenomenon occurring?

Answers

Bhutto jugular unbuilt hru huh huh

6. Explain why some individuals experience
discomfort when they drink milk but can
tolerate yoghurt. (5 marks)

Answers

Answer: Yogurt has less lactose than most dairy products. Everyone responds to dairy differently, so a persons tolerance may be different than another person who’s also lactose intolerant.

Explanation:

Ryan is about to board an airplane to fly to Florida for Spring Break. He is very anxious to fly, but he knows his body is having this normal reaction to a stressor. His palms start to sweat, his heart starts racing, and his breathing becomes much faster in anticipation of the flight. Construct an argument using the observations above of how the body is a system of interacting subsystems. Be sure to include at least two body systems involved and how they are working together during this stress response.

Answers

The body is a system of interacting subsystems as seen in the instance of Ryan for the following reasons:

the nervous system interacts with the respiratory system to increase the breathing ratethe nervous system interacts with the cardiovascular system to increase blood flow.

What are organ systems?

Organ systems refer to the system of organs found in the body that work together to perform one or more specific functions.

There are several organ systems in the body that interact with each other.

Some of the organ systems in the body interacting with each other include:

nervous systemmusculoskeletal systemdigestive systemexcretory systemrespiratory system

The stress response in the body is an example of the interaction of the organ systems in the body.

Learn more about organ systems at: https://brainly.com/question/545314

#SPJ1

which of the following is the incorrect pairing? group of answer choices hippocampus; controls body temperature cerebrum; higher brain functions diencephalon; thalamus, hypothalamus, epithalamus brain stem; midbrain, pons, medulla oblongata amygdala; emotions

Answers

The brain's cerebrum is joined to the spinal cord and cerebellum by a structure called the brainstem. Thalamus, hypothalamus, and epithalamus are its three subregions, in that order.

What are the three functions of the brainstem's three parts?

Anatomy

Midbrain: The control of eye movements is mostly dependent on the brainstem's upper portion.

Pons: The brainstem's central section regulates balance, hearing, and facial movement. Long-stemmed midbrain.

How does the brain stem regulate temperature?

The hypothalamus sits atop the pituitary gland and communicates with it chemically to regulate its activity. It controls hunger and thirst, maintains sleep rhythms, controls body temperature, and contributes to some elements of memory and emotion.

To know more about brainstem visit :-

https://brainly.com/question/5351789

#SPJ4

how many genes are in human body

Answers

Answer:

In humans, genes vary in size from a few hundred DNA bases to more than 2 million bases. An international research effort called the Human Genome Project, which worked to determine the sequence of the human genome and identify the genes that it contains, estimated that humans have between 20,000 and 25,000 genes.

Order the life cycle of very high-mass stars Nebula , protostar, red supergiant, supernova, average star and black hole ?

Answers

Supernova, high mass, nebula and protostar and red supergiant and then last black hole

What enzyme maintains a stock of ATP-G-actin for when the cell needs a burst of ATP-G-actin?

-Profolin

-Thymosin B-4

- ADF/cofilin

Answers

ADF/ cofilin enzyme maintains a stock of ATP-G-actin for when the cell needs a burst of ATP-G-actin. The correct option is C.

Thus, The dynamics of filament assembly are modified by ATP-binding on actin subunits, with ATP-binding often favoring intersubunit interactions and hence filament assembly .

While the rate of subunit loss is independent of the concentration of free ATP-G-actin, the rate of actin addition to filaments is dependent on it. Actin filament development occurs when the rate of addition exceeds the rate of dissociation at high concentrations of free ATP-G-actin.

Small, naturally occurring compounds called toxins, including as phalloidins, cytochalasins, latrunculin A, and jasplakinolide, attach to actin and change how it polymerizes.

Thus, the ideal option is C.

Learn more about ATP G protein, refer to the link:

https://brainly.com/question/10252447

#SPJ1

Other Questions
What is y =- 4 on a graph? Exercise 1 Label each sentence dec. for declarative sentence or imp. for imperative sentence.Lock the door on your way out. Tao uses elimination to solve the following system of linear equations. According to you how important is the UAE's diplomatic initiatives for dealing effectively with the country's strategic threats? I NEED ANSWER NOW PLEASE ITS DUE IN 3 MINS NetFlorist makes two gift packages of fruit. Package A contains 20 peaches, 15 apples and 10 pears. Package B contains 10 peaches, 30 apples and 12 pears. NetFlorist has 40000 peaches, 60000 apples and 27000 pears available for packaging. The profit on package A is R2.00 and the profit on B is R2.50. Assuming that all fruit packaged can be sold, what number of packages of types A and B should be prepared to maximize the profit? What is the maximum profit? (a) Use the information above to formulate an LPP. Indicate what each decision variable represents. [5] (b) Write the LPP in standard normal form. [1] (c) Using the simplex method, solve the LPP. For each simplex tableau, clearly indicate the basic and nonbasic variables, the pivot, row operations and basic feasible solution. A growing trend in food advertising is to market heavily to? Jada bikes 2 miles in 12 minutes. Jada's cousin swims 1 mile in 24 minutes. Who is moving faster? A Jada's cousin is moving faster.BJada is moving faster.C They are both moving at the same rate cal markets has a firmwide wacc of 12.3 percent. division a has a beta of 1.42 and has high risk. the risk-free rate is 3 percent and the market rate of return is 10 percent. management assigns an adjustment factor of 2 to high-risk projects. what is the divisional cost of equity using the objective approach? find the zeroes and multiplicities of the polynomial , f(x)=(x+10)^10(x-7)^2the zeroes are x =the zero x = , has multiplicitythe zero x = , has multiplicity How did you feel after you woke from the bad dream? a shortage occurs whenever select one or more: a. price is less than equilibrium price b. quantity demanded is less than quantity supplied c. quantity demanded exceeds quantity supplied at the equilibrium price d. goods are scarce e. some of the people who need the product are not willing and able to buy it at the equilibrium price Solve the following inequality: -4x+ 14 54 Which is an example of a line segment? the edge of a book the corner of a box a beam of light the floor of a classroom intellectual property is defined as "the creation, ownership, and control of ideas as well as the representation of those ideas." If you spent $20,750 for goods, service and housing in 2000, what would the same purchase have cost in 1984? how could ms. cartwright most effectively extend the nasa activity to incorporate her additional learning goals? three weeks after a river rafting trip, three family members experienced symptoms of coughing, fever, and chest pain. during the rafting trip, the family had consumed crayfish that they caught along the river banks. an examination of the patients' sputum revealed helminth eggs, and serum samples were positive for antibodies to paragonimus. all of the family members recovered following treatment with praziquantel. in the paragonimus life cycle, a) the crayfish are the definitive host and humans are the intermediate host. b) humans are the definitive host and crayfish are the intermediate host. c) both humans and crayfish are intermediate hosts. d) both humans and crayfish are definitive hosts. e) the source of the infection was the river water. magbigay ng halimbawa na nagpapakita ng pagkakaisa ng mga Pilipino at paano ito nakatulong sa bansa at sa mga mamamayang Pilipino?Need na po.. there are four types of rules in applocker. which of the following is not one these rule types?