i am having difficulty with understanding how to do this even though it states instructions. Still does not make much sense. We are working with Prunet squares. I just can't grasp the concept.

I Am Having Difficulty With Understanding How To Do This Even Though It States Instructions. Still Does

Answers

Answer 1

1. YyRr x YyRr

2. Yellow round, Yellow round

3. YYRR, YYRr, YyRR, Yyrr, yyrr, Yyrr, yyRr, YyRr, yyRR

4.

F1 genotypes: YYRR, YYRr, YyRR, Yyrr, yyrr, Yyrr, yyRr, YyRr, yyRR

F1 Phenotypes: yellow round, yellow wrinkled, green round, green wrinkled

I Am Having Difficulty With Understanding How To Do This Even Though It States Instructions. Still Does

Related Questions

What are the phenotypes of the offspring from this cross?

What are the phenotypes of the offspring from this cross?

Answers

Answer:

Phenotypes - Eye color, hair color, pod shape and flower position.

Explanation:

How will soap or alcohol affect the hydrogen bonds between different water molecules?

Answers

Answer:

Soap or alcohol affects the hydrogen bonds between water molecules by making the bond weaker.

Soap or alcohol affects the hydrogen bonds between different water molecules due to their hydrophobic nature. They lower the hydrogen bonding between water by pushing their atoms up.

What are soap and alcohol?

Soap is a component of fatty acid and glycerine. They are hydrophobic, which means they fear water. They are used to washing clothes and bodies. Furthermore, they mix with the oil of the body.

Soap is a surfactant, or a substance that lessens a liquid's surface tension. For instance, soap reduces water's surface tension by weakening the hydrogen bonds that give water its unique properties.

Thus, because they are hydrophobic, soap and alcohol influence the hydrogen bonds that connect various water molecules. By raising their atoms, they reduce the hydrogen bonding between the water molecules.

To learn more about soap and alcohol, refer to the link:

https://brainly.com/question/17271642

#SPJ2

Which scientists concluded that DNA is a three-dimensional molecule? Check all that apply.
O Francis Crick
O Friedrick Miescher
O James Watson
O Maurice Wilkins
O Rosalind Franklin
:`/​

Answers

Answer:

:)))

Explanation:

a and c i think sorry if im wrong

How would you explain the key concepts for the CWA in less than two minutes?

Answers

Answer:

Explanation:

vPoint Source - a source of water discharged to surface water through a discrete point - generally through a pipe, ditch, or channel.

Nonpoint Source - Nonpoint sources, such as parking lots or athletic fields, discharge runoff water to groundwater or surface water; runoff does not come from  a pipe, ditch, or channel. These sources may contain pollutants such as pesticides, motor oil, and soaps.

Navigable Waters of the United States  For the purposes of the Clean Water Act, the term "navigable waters" includes:

all waters used in commerce, including groundwater;

all interstate waters including wetlands, mudflats, and sand-flats; and

all other waters such as lakes, rivers, streams, wetlands and sloughs.

EPA policy states, "The majority of facilities in the U.S. have the potential to discharge to navigable waters."  The Supreme Court decision in (2006) requires the Army Corps of Engineers and the EPA to determine whether there is a "significant nexus" between a navigable waterway and an area a spill might affect.  In June of 2007, EPA and the Army Corps of Engineers released provisional interpretive guidance regarding the "significant nexus” question. According to this guidance, the agencies will assert jurisdiction over traditional navigable waters, wetlands adjacent thereto, and relatively permanent tributaries thereof. The agencies will generally not assert jurisdiction over swales and ditches that lack routine water flow. Finally, the agencies will apply the "significant nexus" requirement and make a case-by-case, fact-specific analysis on impermanent tributaries and other wetlands.

Additional executive orders were issued 2015 in 2019.  Under the 2019 proposal, traditional navigable waters, tributaries to those waters, certain ditches, certain lakes and ponds, impoundments of jurisdictional waters, and wetlands adjacent to jurisdictional waters would be federally regulated. It also details what are not "waters of the United States," such as features that only contain water during or in response to rainfall (e.g., ephemeral features); groundwater; many ditches, including most roadside or farm ditches; prior converted cropland; stormwater control features; and waste treatment systems.

Could the requirement for one or more NPDES Discharge Permit apply to my campus?

If your campus discharges pollutants directly to navigable waters of the United States through a point source, you must obtain an NPDES permit or redirect the flow of the waste.

Stormwater releases from certain activities require an NPDES permit. The most common activities on college campuses requiring NPDES permits for stormwater are construction activities disturbing more than 1 acre, hazardous waste storage areas operating under the Resource Conservation and Recovery Act permit system, steam-generating power plants, and airports. See Stormwater section below.

Regulations issued by local water authorities, or Publicly Owned Treatment Works (POTWs), not NPDES permits, govern discharges into sanitary sewer systems. See Sewer Use (POTW) section below for more information about requirements for using POTWs for commercial or industrial waste disposal.

What do I have to do related to NPDES Discharge Permits?

Determine where wastewater flows from buildings and processes on your campus. Any industrial or commercial operation (e.g., ice rink melt pits, floor drains, and vehicle wash stations) that discharge into a water of the United States may require an NPDES permit. If required, you must obtain such a permit from the appropriate regulatory agency, probably your state environmental agency.

French drains, dry wells, and septic system leach fields are different from point source discharges because they do not immediately affect surface water. Some state and federal environmental agencies manage these systems under the Underground Injection Control program, part of the Safe Drinking Water Act. See Safe Drinking Water Act for more information.

Details of NPDES

37. The bones that make up your backbone are called tarsals.

A. True
B. False​

Answers

Answer:

FALSE IS THE ANSWER.....

That’s False tarsals make up your ankle

you have isolated an aerobic gram-positive, endospore-forming bacterium that grows well on nutrient agar. to which of the following groups does it most likely belong?

Answers

isolated an aerobic gram-positive, endospore-forming bacterium that grows well on nutrient agar is belong to the group Bacillales.

Bacillus, which means "stick" in Latin, is a phylum of Gram-positive, rod-shaped bacteria and contains 266 identified species. The term is also used to refer to the shape (rod) of other similarly shaped bacteria; the phrase is also used to refer to the class of bacteria to which this genus belongs, which is known by the plural Bacilli. Obligate aerobes, which require oxygen to survive, and facultative anaerobes, which may live without it, are two different types of Bacillus species. If oxygen has been utilised or is present, cultured Bacillus species test positive for the enzyme catalase.

Bacillus can transform into oval endospores and can survive for years in this inactive state. One species from Morocco is said to have had its endospore survive being heated to 420 °C. [2] When nutrients are scarce, endospore development often occurs as a result of bacterial division within the cell wall followed by engulfment of one side by the other. They aren't actually spores (i.e., not an offspring).  The genus was initially classified by endospore production, but not all of these species are linked to one another, and many species have been transferred to other genera of the Bacillota.  Each cell only produces one endospore. Heat, cold, radiation, desiccation, and disinfectants cannot harm the spores.

For more such questions on Bacillus , Refer:

https://brainly.com/question/29670729

#SPJ4

why do pickles spoil in rainy season ​

Answers

Answer:

Why do pickles spoils in the rainy season? Pickles spoils in the rainy season because in the rainy season, the moisture content is high in the atmosphere. This high moisture content promotes the growth of microbes or infectious organisms.

Explanation:

Please help!!- timed-60pts!
___________________________
answer individually
___________________________
1. The graph shows the distribution of the weights of individual dogs in a population of dogs.

Answer the following questions using the axes provided.

a) Draw a possible curve for the population several generations later if the population has stabilizing selection

b) draw possible curve for the population several generations later of the population has directional selection

c) draw a possible curve for the population several generations later of the population has a destructive selection

d) how do these selective pressures affect the genetic variation in a population

2.a) in what way is the genetic code, and all organisms of the

Please help!!- timed-60pts!___________________________answer individually___________________________1.

Answers

a) Stabilizing Selection: Narrower and taller curve, peak shifts towards the average weight.

b) Directional Selection: The curve shifts towards the selected extreme phenotype.

c) Destructive Selection: Bimodal curve with peaks at the extreme phenotypes, reduction in the number of dogs with intermediate weights.

a) Stabilizing selection favors the average or intermediate phenotype and reduces the variation in the population. In this case, the curve would become narrower and taller, with the peak shifting towards the average weight (around 30 in this example).

The graph would show a decrease in the number of dogs at the extremes of the weight range and an increase in the number of dogs with weights close to the average.

 

       ^

       |

       |         ----

       |        |    |

Dogs        |    |

       |        |    |

       |        |    |

       |        |    |

       |        |    |

       |___|___|______> Weight (in kg)

       10  20   30   40   50

b) Directional selection favors individuals with a specific phenotype and leads to a shift in the population towards that extreme phenotype. If there is directional selection for higher weight, the curve would shift to the right, indicating an increase in the number of dogs with weights greater than the average.

The curve would become broader and flatter on the left side (lower weights) and narrower and taller on the right side (higher weights).

       ^

       |

       |              ------

       |             |

Dogs             |            

       |             |

       |             |

       |             |

       |             |

       |______|______> Weight (in kg)

      10   20   30   40   50

c) Destructive selection occurs when extreme phenotypes are favored, leading to a reduction in the overall population size. In this case, the curve would become bimodal or have multiple peaks.

The peak(s) would shift towards the extremes (e.g., very low and very high weights), and the number of dogs in the intermediate weight range would decrease. The curve would show a decrease in the number of dogs with weights close to the average.

       ^

       |

       |   ----              --------

       |  |    |              |        |

Dogs  |    |              |        |

       |  |    |              |        |

       |  |    |              |        |

       |  |    |               |       |

       |_|__|______|____|______> Weight (in kg)

        10    20   30   40  50

d) Stabilizing selection reduces genetic variation because it favors the average phenotype and reduces the frequency of extreme phenotypes. This decreases the overall range of genetic variation in the population.

Directional selection can either decrease or increase genetic variation, depending on the specific selection pressure. If the selection pressure is consistent over time, genetic variation may decrease as individuals with extreme phenotypes become more common.

However, if the selection pressure changes or fluctuates, it may maintain or even increase genetic variation as different phenotypes are favored at different times.

Destructive selection can also reduce genetic variation by favoring extreme phenotypes and reducing the number of individuals with intermediate phenotypes. This can result in a narrower range of genetic variation in the population.

For more such questions on stabilizing selection: https://brainly.com/question/3490954

#SPJ11

Which of the following occurs when population exceeds its carrying capacity? O Nothing happens O Overpopulation O More Resources O Less competition​

Answers

Answer:

B) Overpopulation.

Explanation:
When population exceeds its carrying capacity, the result is overpopulation. Therefore, the answer to your question is "Overpopulation". This concept is mentioned in result #9, which states that limiting factors determine an ecosystem's carrying capacity , which is the maximum population size the environment can support given all available resources . When the population size exceeds this limit, resources become scarce, and the environment is unable to sustain the population, leading to overpopulation.

Answer:

The Effects of Overpopulation, More people means an increased demand for food, water, housing, energy, healthcare, transportation, and more. And all that consumption contributes to ecological degradation, increased conflicts, and a higher risk of large-scale disasters like pandemics

So I would say B is the answer

Which sport is required to have both male and female competitors ?
A. Hockey
B. Water polo
C. Mixed doubles tennis
D. Swimming

Answers

Answer: Equestrian: An Olympic sport in which competitors ride horses, male and female riders compete head top head against each other in eventing, dressage and show jumping disciplines.

Use your codon chart to determine the amino acid sequence. Remember to read through the strand and ONLY start on AUG and STOP when you reach a stop codon (UGA, UAA, or UAG). Follow the example in the box. Abbreviate the proteins using the first three letters of the amino acid name.

Answers

Methionine (AUG)Amino acids can be abbreviated using the first three letters of their name.

Methionine can be abbreviated as Met.

The given RNA sequence is AUGUAACGAUGCGUCGUGGCAUCAUGCUGCGUCAGCGGCGAGUCUGACCCGUCUCUAACAGGACGGCCGGGCGUUGUCGUUGA.

We can use the codon chart to determine the amino acid sequence.

The codon chart is used to determine which amino acid is coded by a particular codon in a strand of DNA/RNA.A codon is a sequence of three nucleotides in DNA or RNA that encodes for a specific amino acid.

Each codon codes for a different amino acid.

For example, the codon AUG codes for the amino acid methionine.

To determine the amino acid sequence, we start reading the RNA strand from the start codon AUG and continue reading until we reach a stop codon (UGA, UAA, or UAG).

Then we write down the amino acid sequence for the codons we read, using the codon chart.

Here, the sequence starts with AUG, which codes for methionine.

After that, the next codon is UAA which is a stop codon, so we can stop.

The amino acid sequence is therefore Methionine. So, the answer would be Methionine (Met).

For more such questions on Methionine

https://brainly.com/question/29481268

#SPJ8

8. Under what conditions do animals use the following food for respiration; (a) Carbohydrates When.. (b) Fats (c) Tissue proteins ​

Answers

Animals utilize carbohydrates for energy production during periods of high activity or immediate energy needs. Fats are used when energy demands are sustained or during fasting. Tissue proteins are used as a last resort during prolonged starvation or extreme conditions.

Carbohydrates: Animals primarily utilize carbohydrates for energy production when immediate energy needs arise. During periods of high activity, such as exercise or intense physical exertion, carbohydrates serve as a readily available energy source. They are broken down into glucose, which can be quickly metabolized to provide energy for cellular processes.Fats: When energy demands are sustained or during fasting, animals turn to fats for energy production. Fats are stored in adipose tissues and provide a concentrated source of energy. They are broken down into fatty acids and undergo beta-oxidation to generate ATP, the cellular energy currency.Tissue Proteins: Tissue proteins are typically spared for energy production and serve as a last resort. In cases of prolonged starvation or extreme conditions where carbohydrates and fats are insufficient, the body may resort to breaking down tissue proteins. This process, known as proteolysis, converts proteins into amino acids, which can be further metabolized to produce energy.

It's important to note that the utilization of these energy sources is highly regulated by the body and depends on factors such as energy availability, metabolic state, and specific physiological demands.

For more more more on Carbohydrates

https://brainly.com/question/336775

#SPJ8

The complete question may be like :

Under what conditions do animals utilize carbohydrates, fats, and tissue proteins for energy production?




Which of the following events is an important part of the engineering design process?
A.
testing and evaluating models
B.
evaluating design constraints
C.
designing and building models
D.
all of these
PLS QUICKLY ANSWER

Answers

D. all of these are important parts of the engineering design process. Testing and evaluating models, evaluating design constraints, and designing and building models are all key steps in the iterative process of engineering design.

What is an engineering?

Engineering is a field of study and practice that involves the application of scientific and mathematical principles to design, develop, build, and maintain structures, machines, systems, processes, and materials that solve practical problems and improve our lives. Engineers use creativity, critical thinking, and technical knowledge to address challenges related to a wide range of industries.

What is desigh constraints?

Design constraints are the limitations, requirements, or conditions that must be taken into account when creating a design solution. They may be imposed by various factors, such as the project's scope, budget, timeline, regulatory requirements, safety standards, environmental concerns, user needs, or technological limitations.

To know more about engineering, visit:

https://brainly.com/question/19117846

#SPJ1

Which of the following is a trace fossil? *
a mark left by a dinosaur's tail
a mosquito trapped in amber
a mummified plant seed
O a frozen woolly mammoth
which

Answers

Answer:

A. A mark left by a dinosaur's tail.

Explanation:

A trace fossil is the mark or imprint of an animal's body or something it did or left behind, rather than the physical animal itself.

Hope this helps :)

Write your research using your outline and the research you’ve collected. Be sure to proofread and revise your writing to catch any errors in grammar, spelling, logic, or cohesion. Remember that you must add a works cited page at the end of your paper to give credit to your sources. When you have completed your paper, submit it to your teacher along with this activity.

Write your research using your outline and the research youve collected. Be sure to proofread and revise

Answers

In today’s world, technology has become an integral part of our lives. It has changed the way we think, the way we work, and the way we learn. Technology has had a profound impact on education.

What is education?

Education is the process of facilitating learning, or the acquisition of knowledge, skills, values, beliefs, and habits. Educational methods include storytelling, discussion, teaching, training, and directed research. Education is commonly divided into stages such as preschool, kindergarten, primary school, secondary school, and higher education. It is a key driver of economic and social development, with a strong influence on socio-economic outcomes such as income, health, employment rates, and gender equality.

The Benefits and Drawbacks of Technology in the Classroom

The use of technology in the classroom offers many potential benefits for students. Technology can help to engage students and make learning more interactive. For example, technology can provide students with access to real-world examples that can bring abstract concepts to life.

To learn more about education

https://brainly.com/question/27010145

#SPJ1

Which of the following is NOT a correct description of cnidarian nervous tissues?

Answers

Answer:

Three tissue layers I think

In a population the homozygous dominant individual make up 70% of the population while heterozygous ones made up 21% and recessive made up 9%. What are the frequencies of the A and a alleles?

Answers

There are two alleles in a population that influence a specific attribute. Using the letters "A" for the dominant allele and "a" for the recessive allele. A allele frequency is 0.7, whereas frequency of allele is 0.09.

The frequency of the A allele is 0.7, or 70%, since homozygous dominant (AA) genotypes account for 70% of the population. Similarly, since homozygous recessive (aa) alleles make up 9% of the population, we can infer that the frequency of the recessive allele, a, is 0.09, or 9%.

The formula 2pq = frequency of heterozygotes, where p is the frequency of the A allele and q is the frequency of the an allele, can be used to determine the frequency of the heterozygous genotype (Aa).

We know that the frequency of heterozygotes is 0.21, or 21%.

Plugging in the known values:

2 * 0.7 * q = 0.21

Solving for q:

q = 0.15

So, the frequency of the A allele is 0.7, and the frequency of the a allele is 0.09.

For more such questions on Frequency of Allele

https://brainly.com/question/31063397

#SPJ11

The fact that all mammals have mammary glands that produce milk for their young is evidence that all mammals have a ____?

Answers

Answer:

The fact that all mammals have mammary glands that produce milk for their young is evidence that all mammals have a common ancestor.

Explanation:

This is because the presence of mammary glands is a shared characteristic that evolved in the common ancestor of all mammals, and has been passed down to all of their descendants through the process of evolution by natural selection. This shared characteristic is an example of a homologous trait, which is a trait that is similar in different species because it was inherited from a common ancestor.

the role of you to make good society​

Answers

By being a good human being, following moral values we can build a good society.

Economy is growing, GDP is flawed. Wars an Natural disasters are good for GDP. Aristotle in order to make good society, he said, the society must create the pre-conditions. For him the good society was the one that created the conditions for what he calls "Eudaimonia", which means flourishing or thriving.

First are the basic needs of humans that is Food, Shelter, Water and Secondly the amenities for building a successful and good lifestyle and better life.

Moreover, every individual should have freedom to speech, fundamental rights, an attitude of gratitude as well. A person should be a giver, a giver to needy ones, giver of happiness that is spreading happiness, rather than negativity.

Read more about good society,

https://brainly.com/question/12116623

The results of a different cross of guinea pigs are 19 black rough: 6 black smooth : 7 white rough: 2
white smooth. What are the most probable genotypes of the parents?

Answers

Assuming a single diallelic gene coding for each trait, expressing complete dominance, and with no interaction between genes, the most probable genotypes of the parents are BbRr. Both parents must be dihybrids.

Available data

In this example, two features are considered,

type of fur ⇒ rough or smoothfur color ⇒ black or white

After the cross, the results of the progeny were as follows,

19 black rough individuals.6 black smooth individuals.7 white rough individuals.2 white smooth individuals.

Total number of pigs among the progeny = 19 + 6 + 7 + 1 = 34 pigs.

We will assume that of these traits are coded by a single diallelic gene each, that express complete dominance, and do not interact with each other.  

If we perform a cross considering this two genes, we will expect to get 16 possible combinations of the parental gametes.  

So, the 34 pigs from the progeny are included in these 16 possible genotypes.

34 pigs ---------------------- 16 combinations

19 black and rough ----- X = (19 x 16) / 34 = 8.94 ≅ 9

6 black and smooth ----- X = (6 x 16) / 34 = 2.82 ≅ 3

7 white and rough ------- X = (7 x 16) / 34 = 3.2 ≅ 3

2 white and smooth ----- X = (2  x 16) / 34 = 0.94 ≅ 1

So, by looking at the phenotypic proportions of the progeny, we can suggest the possible parental genotypes.

Phenotypic proportion

9/16 black and rough pigs3/16 black and smooth pigs3/16 white and rough pigs1/16 white and smooth pigs.

These proportions are the result of a cross between two dihybrid individuals, meaning that both parents are heter0zyg0us for both traits.

Also, according to these numbers, we can tell that the dominant traits are black and rough over white and smooth, respectively.

So let us make this cross assuming two dihybrid parents,

Parentals) BbRr    x    BbRr

Gametes) BR, Br, bR, br

                 BR, Br, bR, br

Punnett square)         BR          Br        bR         br

                       BR     BBRR    BBRr    BbRR    BbRr

                       Br      BBRr     BBrr      BbRr     Bbrr

                       bR      BbRR    BbRr    bbRR     bbRr

                       br       BbRr     Bbrr     bbRr       bbrr

F1) Genotypes

1/16 BBRR2/16 BBRr1/16 BBrr2/16 BbRR4/16 BbRr2/16 Bbrr1/16 bbRR2/16 bbRr1/16 bbrr

Genotypic ratio ⇒ 1:2:1:2:4:2:1:2:1

     Phenotypes

9/16 Black and rough pigs, B-R- 3/16 Blanc and smooth pigs, B-rr3/16 White and rough pigs, bbR-1/16 white and smooth pigs, bbrr.

Phenotypic ratio ⇒ 9:3:3:1

In conclusion, The most probable genotypes of the parents are BbRr, being dihybrid both of them.

You will learn more about phenotypic proportions at

https://brainly.com/question/13417256

https://brainly.com/question/26423039

https://brainly.com/question/4372437

You are performing a dissection and have discovered a fluid vessel, but you don’t know if it is from the cardiovascular system or from the lymphatic system. Finding which of the following features will confirm that this can only be a lymph vessel?
a. The presence of valves
b. The presence of three tunics (intima, media, and externa)
c. Designed to handle low fluid pressure
d. One-way flow of fluid
e. Presence of anchoring filaments f. Connection to the heart

Answers

The following features which will confirm that this can only be a lymph vessel include the following:

c. Designed to handle low fluid pressure

d. One-way flow of fluid

f. Connection to the heart.

What is Lymphatic vessel?

This is referred to as the network of capillaries and tubes which are located throughout the body and transport lymph away from tissues. they are also involved in the collection and draining of lymph and it is usually done at the node region.

This type of vessel works under low pressure and allows the flow of fluid in only one direction. This is enhanced by the presence of the semilunar valves.

It is connected to the heart as it helps drain tissue fluid in order to maintain the steady-state interstitial fluid equilibrium thereby making it the correct choice.

Read more about Lymphatic vessel here https://brainly.com/question/1226557

#SPJ1

If a city
were a model for a cell,
would wastewater be more
likely part of endocytosis or
exocytosis? Explain.

Answers

If a city were a model for a cell, would wastewater be more likely part of endocytosis.

Briefing:

The process of engulfing an object or particle with the cell membrane and bringing it inside the cell is known as endocytosis. The membrane completely encloses the substance by folding it over.

What is an endocytosis ?

Endocytosis is the process by which cells take in foreign material by encasing it in their membrane. The two primary kinds of endocytosis are ocytosis and receptor-mediated endocytosis.

What is endocytosis transport?

Endocytosis is a term that refers to a variety of active transport processes that carry particles into cells by encasing it in vesicles made of plasma membranes (endo = internal, cytosis = transport mechanism).

To know more about Endocytosis visit:

https://brainly.com/question/26500494

#SPJ13

For the last 30 years, human use of fertilizers has had a significant impact on the nitrogen

cycle. Which statement explains how fertilizers impact an ecosystem?

O Fertilizers increase the amount of fixed nitrogen available in the ecosystem.

O Fertilizers decrease the amount of nitrogen fixed by organisms living in the ecosystem.

O Fertilizers kill off important nitrogen fixing bacteria.

Fertilizers decrease the amount of fixed nitrogen available in the ecosystem.

Answers

Answer:

It's C

Explanation:

Hope this helped :)))

The fertilizers show a significant impact on the nitrogen cycle as the fertilizers kill off the important nitrogen fixing bacteria which are present in the soil. Thus, the correct option is C.

What is Nitrogen cycle?

Nitrogen Cycle is a biogeochemical process through which the nitrogen present in the environment is converted into many different forms, consecutively passing from the atmosphere to the soil to the living organisms and back into the atmosphere after decomposition. It involves several processes including the nitrogen fixation, nitrification, denitrification, decay and putrefaction of the nitrogen compounds.

Intensive fertilization of the agricultural soils of normal soil can increase the rates at which nitrogen in the form of ammonia is volatilized in the environment and lost to the air. It can also speed the microbial breakdown of ammonium and nitrates in the soil which results into enhancing the release of nitrous oxide. In addition to this, excessive use of fertilizers also kills the nitrogen fixing bacteria present in the soil.

Therefore, the correct option is C.

Learn more about Nitrogen cycle here:

https://brainly.com/question/1615727

#SPJ2

The Amazon rainforest in South America is the largest rainforest ecosystem in the world. Ecuador's Yasuni National Park, which is in the Amazon rainforest, has many different species of plants, birds, and mammals.
Which statements describe the Yasuni National Park ecosystem? Select all that apply.

A) It has soil that is poor in nutrients
B) it has year-round rain and warm temperatures
C) it has many different types of organisms

Answers

Answer:

B & C, because the Amazon rainforest is warm and has rain all year. Also it has many different varieties of plants and animals. Since Yanuni National Park is in the Amazon rainforest, it would be the same.

Explanation:

Brainliest, Please! (And Happy Halloween!)

Answer:

b and c

Explanation:

because the Amazon rainforest is warm and has rain all year. Also it has many different varieties of plants and animals. Since Yanuni National Park is in the Amazon rainforest, it would be the same.

Brainliest, Please!

Fill in the blanks
Nebulae are____ where____ can form.

Dust and gas
Stars
Light
Gravity
Plants

SOMEONE HELP!

Answers

Nebulae are Dust and gas where Stars can form, hence option A, B.

How is nebula formed?

Although there are less than ten atoms per cubic meter in intergalactic space, it is not completely vacuum. Nature, after all, detests emptiness! When a few atoms are close enough to one another to clump together, a nebula starts to form. Naturally, the gravitational influence of atoms increases with the number of clumps they form. Eventually, a sizable gaseous cloud forms in space as a result of them being able to drag even more particles toward them.

A nebula is primarily a cloud of gas and dust in space; when there are several, they are collectively referred to as nebulae. Some of the most beautiful celestial phenomena are nebulae, and many of them have been given names that refer to things we are familiar with, like the land.

Therefore, option A, B are correct.

Learn more about Nebulae at:

https://brainly.com/question/29138828

#SPJ1

Which of the circumstances below most accurately describes conditions that are likely to permit a robust anti-tumor adaptive immune response?

a. A tumor with high expression of proteins that have mutations in sequences encoding HLA-binding peptides.
b. A robust acute inflammatory response to PAMPs expressed specifically by tumor cells.
c. Anti-tumor T lymphocytes that have high expression of CTLA-4.
d. A tumor with high expression of PD-L1.

Answers

Did you ever figure out the answer to this question?

The study of PAMP-DAMP complexes is vital to the advancement of knowledge regarding inflammatory disorders in general and cancer in particular. Therefore, option (B) is correct.

What is PAMP-DAMP complexes?

Increasing evidence links inflammation to cancer, and at the root of inflammation are PAMPs and DAMPs (DAMPs). Microorganisms contain PAMPs, which are detected by pattern recognition receptors on monocytes and DCs (PRRs). PRR activation produces pro-inflammatory cytokines.

A robust immune response requires endogenous chemicals that pose 'risk' to self-tissues and are created by injured or stressed cells; these are DAMPs, which also trigger inflammation. PAMPs and DAMPs each have about 100 receptors. PAMPs and DAMPs interact; a PRR can bind to both. In this system, PAMPs and DAMPs affect each other's activation threshold. Thus, PAMP-DAMP relationships describe inflammation in a predictable 'inflammatory code'

PAMP-DAMP complexes are key to understanding inflammatory disorders and cancer.

Learn more about adaptive immune response, here:

https://brainly.com/question/28073370

#SPJ5

A machine has an efficiency of 80%. How much work must be done on the machine so to make it do 50,000 J of
output work?
12,500 J
40,000 J
62,500 J
90,000 J

Answers

Answer:

62,500 J

Explanation:

50,000/0.8=62,500

Answer:

62,500

Explanation:

Question 5 of 10 What general rule describes what happens to the energy in a given trophic level? OA. Only about 10% of all the energy in a trophic level gets used for metabolism. OB. Only about 90% of all the energy in a trophic level gets used for metabolism. O C. Only about 10% of all the energy in a trophic level gets transferred to the next level. OD. Only about 90% of all the energy in a trophic level gets transferred to the next level.​ the answer is C

Answers

The general rule that describes what happens to the energy in a given trophic level is as follows: Only about 10% of all the energy in a trophic level gets transferred to the next level (option C).

What is trophic level?

Trophic level in ecology is the particular position occupied by a group of organisms in a food chain.

A food chain is the feeding relationships between species in a biotic community. In the food chain, living organisms derive energy from one another by feeding on one another.

However, 90% of energy is used by the living organisms that occupies the trophic level. This means only about 10% is transferred from one trophic level to another.

Learn more about trophic level at: https://brainly.com/question/13267084

#SPJ1

Available energy ___________ as it is transferred from one organism to another in a food chain.

Answers

Answer:Key Points. Energy decreases as it moves up trophic levels because energy is lost as metabolic heat when the organisms from one trophic level are consumed by organisms from the next level.

Explanation:

Definition: The time in an age-structure diagram where the population is reproducing.

Answers

it is biotic potential!!!!

Answer:Reproductive

Explanation: just took the test

Other Questions
Which of the following bodies of water are identified correctly on the map above?i. Number 3 is the Amazon River.ii. Number 6 is the Atlantic Ocean.iii. Number 7 is the Pacific Ocean.A.i. onlyB.ii. and iii. onlyC.i., ii., and iii.D.None of the bodies of water is identified correctly. add, then write sum 7/10 + 2/10 Determine the slope of the tangent line to f(x) = sin(5x) at x = /4a. -52/2b. 0c. 52/4d. 5 How do you play Tennis for Two? How do I solve this question? The equation below describes a proportional relationship between x and y. What is the constant of proportionality? Use pencil and paper. Explain why your answer is called the "constant of proportionality."y=3.13xQuestion content area bottomPart 1The constant of proportionality is Match the system of linear equations on the left with its solution type on the right 1. Y=2x-1Y=2x+12. Y-4x=-2 What is meant by "concentration"? How can you increase the concentration of salt (electrolytes) in a solution of water? How can you decrease the concentration of electrolytes in a solution? A square has a perimeter of 20 cm. What is the length of each side In terms of per capita earnings, Saudi Arabia is wealthier than Turkey. This particular measurement is misleading. Why? The first step of the accounting cycle is to _____. post journal entries to the ledger prepare an unadjusted trial balance analyze the adjustment entries analyze and record the transactions in the journal HELP ASAP! I WILL GIVE BRAINLYYYY AND POINTS a car is traveling at a constant speed on the highway. its tires have a diameter of 62.0 cm and are rolling without sliding or slipping. if the angular speed of the tires is 47.0 rad/s , what is the speed of the car? express your answer with the appropriate units. All immigrants to the United States in the early 1900s had to go through Ellis Island.True or False a_____is a program that attaches itself to a file, spreads to other files, and delivers a destructive action called a payload. A blue spruce grows an average of 6 inches per year and a hemlock grows an average of 4 inches per year. If a blue spruce is currently 4 feet tall and a hemlock is 6 feet tall , when would you expect the trees to be the same height. True or false 9x10^-5 is 0.01 times as much as 9x10^-3 two car manufacturers, nissa and honda, have fixed costs of $1 billion and marginal costs of $20,000 per car. if nissan produces 50,000 cars per year and honda produces 200,000 cars per year, calculate the average production cost for each compan Correct punctuation there are 3 in total Evaluate -4|-4|.0-8816-16