how have biological sources of change affected the history of life

Answers

Answer 1

Biological sources of change affected the history of life in several ways such as, Evolution, Speciation, Extinction, Adaptation etc

How have biological sources of change affected the history of life?

Evolution: Evolution  is the method by which species alter over time through hereditary variety and normal choice. Advancement has driven to the differences of life on Soil, with unused species advancing and old species going terminated. The method of advancement has been driven by a assortment of variables, counting changes within the environment, competition between species, and hereditary changes.

Speciation: Natural advancement has too driven to the arrangement of modern species through a handle known as speciation. This happens when populaces of a species gotten to be separated from each other and experience hereditary changes that make them unmistakable from one another. Over time, these changes can gather until the two populaces are not able to interbreed, at which point they are considered partitioned species.

Extinction: Organic sources of alter have moreover driven to the termination of numerous species over time. Termination can happen due to a assortment of variables, counting changes within the environment, competition between species, and human exercises such as chasing and living space pulverization.

Adaptation: Natural sources of alter have moreover driven to the adjustment of species to their situations. Through the method of normal choice, species that are better adapted to their environment are more likely to outlive and replicate, passing on their profitable characteristics to their sibling.

By and large, organic sources of alter have been a major driver of the history of life on Soil. They have driven to the advancement of unused species, the termination of others, and the adjustment of species to their situations.

Learn more about biological evolution from

https://brainly.com/question/4822518

#SPJ1


Related Questions

arterial thrombi are composed of erythrocytes with larger amounts of fibrin and very few platelets, whereas venous thrombi are composed of mostly platelets held together by fibrin strands. select one: true false

Answers

Endothelial dysfunction is linked to venous thromboembolism (also known as deep venous thrombosis and pulmonary embolism, or VTE for short).

What is the erythrocyte's primary purpose?

Erythrocytes, also referred to as red blood cells, carry oxygen to your body's tissues. As breath is metabolized, co2 is released by your cells. Additionally, our red plasma cells carry carbon dioxide to the lungs so you can exhale it.

What does having a high erythrocyte count mean?

What does a high red plasma cell count indicate? You have erythrocytosis, which is defined as having a high red plasma cell count. As a result, your blood is thicker than it ought to be, which raises the possibility of blood clots.

To know more about Erythrocyte visit:

https://brainly.com/question/16794540

#SPJ4

is a newspaper article that expresses an opinion called a tabulated material ?

Answers

The statement "a newspaper article that expresses an opinion called a tabulated material" is definitely false.

What do you mean by Tabulated material?

Tabulated material may be defined as any written content that is assembled in a table, with rows and columns.

The articles of newspapers are never assembled in tabular form. They are always aligned in the normal way of paragraphs with suitable spaces.

Therefore, the statement "a newspaper article that expresses an opinion called a tabulated material" is definitely false.

To learn more about Tabulated material, refer to the link:

https://brainly.com/question/17563681

#SPJ1

A geologist finds some tilted sedimentary rock layers.

Which conclusion can the geologist draw by looking at the rock layers?

A.) Their absolute age is 600 million years.
B.) They were tilted before they were deposited.
C.) They were originally deposited horizontally.
D.) The youngest layer was originally deposited as the bottom layer.

Answers

Answer:

a

Explanation:

Answer:

C) They were originally deposited horizontally.

Explanation:

ll are true statements concerning epinephrine except: it elevates the systolic blood pressure. it decreases the heart rate and cardiac output. it dilates the bronchial tubes. it dilates the pupils.

Answers

Epinephrine doesn't increase cardiac output or heart rate, which is a misleading claim.

The adrenal gland releases the hormone epinephrine in reaction to stress or danger. It raises blood pressure, cardiac output, and heart rate via acting on the sympathetic nervous system. In addition to dilating the pupils to improve vision, epinephrine also expands the bronchial passages to promote breathing. These side effects are a result of the body's fight-or-flight reaction and aid in getting the body ready to react to a perceived threat. However, epinephrine can also cause undesirable side effects like tremors, anxiety, and elevated blood sugar. Asthma attacks, cardiac arrest, and severe allergic reactions are all regularly treated with it in medicine.

learn more about epinephrine here:

https://brainly.com/question/30160747

#SPJ11

If one wanted to find the largest number of endemic species, one should visit which of the following geological features (assuming each has existed for several millions of years)?
a) an isolated ocean island in the tropics
b) an extensive mountain range
c)a midcontinental grassland with extreme climatic conditions
d) a shallow estuary on a warm-water coast
e) all of the above

Answers

Endemic species are those that are found in a specific region and nowhere else on the planet.

Here correct answer is E

Different geological features provide a greater range of habitats to support a larger number of endemic species. An isolated ocean island in the tropics lends to an increased species diversity compared to mainland due to its isolation.

An extensive mountain range can have numerous habitats and climatic conditions, leading to more species diversification. A midcontinental grassland with extreme climatic conditions again can have various habitats and provide additional species diversification. A shallow estuary on a warm-water coast brings its own set of unique ecosystems and habitats, thus providing an additional source of endemism.

All of these geological features have each existed for millions of years, forming unique species that cannot be found elsewhere, thus providing an opportunity the largest number of endemic species.

Know more about Endemic species here

https://brainly.com/question/32034649#

#SPJ11

write two examples of consumers tell whether they are herbivores omnivores carnivors or scavengers

Answers

Answers

Lion,Tiger -Carnivores

vulture- scavenger

Cow,sheep -Herbivores

Man, Pig -Omnivores

A panda (herbivore) eats bamboo shoots and leaves, while a lion (carnivore) preys on other animals.A bear (omnivore) eats both plants and animals, while a vulture (scavenger) feeds on the remains of dead animals.What are consumers?

In an ecosystem, consumers are organisms that obtain their energy and nutrients by feeding on other organisms. They are a vital part of the food chain, and they come in different sizes and types.

Consumers can be classified into several categories based on what they eat. For example:

Herbivores: These are animals that consume only plants for their food. Examples include rabbits, cows, and giraffes.

Carnivores: These are animals that consume other animals for their food. Examples include lions, tigers, and sharks.

Omnivores: These are animals that eat both plants and animals. Examples include humans, bears, and raccoons.

Scavengers: These are animals that feed on the remains of dead organisms. Examples include vultures, hyenas, and some types of beetles.

Consumers play an important role in an ecosystem, as they help to transfer energy and nutrients from one level of the food chain to another. They are an integral part of maintaining the balance and stability of an ecosystem.

Learn more abut consumers, here:

https://brainly.com/question/15869639

#SPJ5

What term describes the light-absorbing molecule that plants use to absorb energy?

A Grana
B Pigments
C Stroma
D thylakoids

Answers

B.Pigments:)))))))))))))

Pigments, are the light-absorbing molecule that plants use to absorb energy, chlorophyll is the light absorbing pigment, hence option B is correct.

What is chlorophyll?

Plants get their green color from a pigment called chlorophyll, which also aids in photosynthesis, which is how plants make their own food.

In a plant, chlorophyll's function is to absorb light, often sunlight. Two types of energy storing molecules receive the light energy that is absorbed.

The plant uses its stored energy to turn water and carbon dioxide from the air into glucose, a form of sugar, through photosynthesis.

Therefore, chlorophyll is a pigment, considered as a light absorbing molecule that plants use to absorb energy, hence option B is correct.

Learn more about chlorophyll, here:

https://brainly.com/question/13500580

#SPJ2

Indicate the correct order of steps for a broth to agar plate transfer Rank the options below Remove a loopful of bacterial culture from the broth tube, pass the mouth of the tube through the Bunsen burner flame, and N replace the cap. Lift the lid of the agar plate slightly and streak the loop across the surface of the agar plate. Replace lid. Sterilize inoculating loop, remove cap of culture tube, and pass mouth of culture tube through the Bunsen burner flame. 1 Sterilize inoculating loop prior to replacing in loop holder.

Answers

The correct order of steps for a broth to agar plate transfer is:

Sterilize the inoculating loop prior to replacing it in the loop holder.

Sterilize the loop again, remove the cap of the culture tube, and pass the mouth of the culture tube through the Bunsen burner flame.

Remove a loopful of bacterial culture from the broth tube, pass the mouth of the tube through the Bunsen burner flame, and replace the cap.

Lift the lid of the agar plate slightly and streak the loop across the surface of the agar plate.

Replace the lid.

Sterilize the loop, transfer culture, and streak agar.

How do you transfer culture to agar using a loop?

To transfer bacterial culture from a liquid broth to an agar plate, it is important to maintain aseptic technique to prevent contamination. The process involves sterilizing the inoculating loop prior to use by passing it through a flame. The culture tube's cap is removed, and the mouth of the tube is passed through the Bunsen burner flame to eliminate potential contaminants.

A loopful of the bacterial culture is then taken from the broth tube and the tube is promptly recapped. The lid of the agar plate is lifted slightly, and the loop is streaked across the surface of the agar to evenly distribute the culture. Finally, the plate's lid is replaced to maintain sterility.

This method allows for the growth of individual bacterial colonies on the agar plate, facilitating further analysis and experimentation.

Learn more about Bacterial culture transfer

brainly.com/question/28546120

#SPJ11


Who used x-rays to study DNA?

Answers

Answer:

Rosalind Franklin used x-rays to study DNA

Ms. Tierney arrives in the Emergency Department with a burn that extends throughout the dermis and epidermis. It is hard, dry, and leathery with a brown to black color, and in one area it seems to have extended into the subcutaneous fat layer. Ms. Tierney's burn is most likely a ___ burn.

Answers

Third degree or full thickness

the energy in living systems is used by organisms for what purpose?

the energy in living systems is used by organisms for what purpose?

Answers

Answer:

a

Explanation:

Please help ASAP!

Which of these is an organic nutrient?

A) phosphorus
B) calcium
C) water
D) proteins

Answers

Answer: the answer is D

Which statement describes one feature of chemical changes? They never change a substance’s properties. They change a substance’s identity. They can usually be reversed. They keep a substance’s arrangement of atoms the same.

Answers

They change a substance’s identity.

Answer:

They change a substance’s identity.

Explanation:

how do plant cells obtain oxygen for respiration [worth 9 marks]

Answers

Answer:

As with photosynthesis, plants get oxygen from the air through the stomata. Respiration takes place in the mitochondria of the cell in the presence of oxygen, which is called "aerobic respiration".

What must scientists assume when using scientific laws to make
predictions?

Answers

Scientists must assume that scientific laws are accurate, applicable, and based on reliable data for making predictions.

When using scientific laws to make predictions, scientists must assume certain foundational principles. Firstly, they assume that the scientific laws are accurate representations of natural phenomena and that they apply universally under the given conditions. Scientists also assume that the conditions and variables influencing the system remain constant, allowing for reliable predictions. Furthermore, they assume that the laws are based on sufficient and representative data, and that there are no unaccounted factors or biases that could significantly affect the predictions. Scientists also assume that the laws will continue to hold true in the future, allowing for the extrapolation of predictions beyond observed data. However, it is important for scientists to continuously evaluate and refine their assumptions as new evidence and knowledge emerge, promoting the progress and refinement of scientific understanding.

For more such questions on Scientific laws:

https://brainly.com/question/20279776

#SPJ8

What is the definition of Stabilizing selection, directional selection and disruptive selection (make your sentence short and in your OWN words)

Answers

Answer:

Stabilizing selection is a type of natural selection in which the population mean stabilizes on a particular non-extreme trait value.

directional selection is a mode of natural selection is  an extreme phenotype is favored over other phenotypes.

Disruptive selection describes changes in population genetics in which extreme values for a trait are favored over intermediate values.

Cougars are predators that often eat weakened or diseased animals. This is a description of the _____ of cougars.

Answers

niche should be the correct answer

which method of collecting self-reported data has the lowest response rate?

Answers

The method of collecting self-reported data with the lowest response rate is typically mail surveys.

Response rate refers to the percentage of people who participate in a survey compared to the total number of people who were invited to participate. Collecting refers to the process of gathering data from participants. Mail surveys often have lower response rates because they rely on participants to physically return the survey, which can be less convenient and more time-consuming than other methods such as online or telephone surveys.If you are planning to conduct a mail survey, there are a few things you can do to increase your response rate. First, make sure your survey is well-designed and easy to complete. Second, send out multiple reminders to your participants. Third, offer incentives for completing the survey, such as a chance to win a prize or a discount on a product or service.

For further information on Response rate visit:

https://brainly.com/question/30829914

#SPJ11

Please help! skin melanocytes produce the protein melanin, which gives the skin pigment. muscle cells do not produce melanin. which statement explains this difference between skin melanocytes and muscle cells?

A. muscle cells rely on rna, while melanocytes rely on dna.

B. melanocytes and muscle cells express different genes.

C. muscle cells destroyed the gene for melanin, but melanocytes did not.

D. melanocytes contain different genes from muscle cells

Answers

Answer:

The correct answer is B. "Melanocytes and muscle cells express different genes."

Although all cells in an organism (such as a human) contain the same DNA, different cell types express different sets of genes. Gene expression is the process by which specific genes are activated to produce a needed protein. In this case, the gene responsible for melanin production is expressed in melanocytes, but not in muscle cells.

This does not mean that muscle cells have destroyed the gene for melanin (as stated in option C) or that melanocytes contain different genes from muscle cells (as stated in option D). All cells within an organism contain the same genes, but not all genes are expressed in every cell. The process of gene expression is regulated by the cell to ensure that each cell type functions properly.

Option A is also incorrect because all cells, including both muscle cells and melanocytes, rely on both DNA (for storing genetic information) and RNA (for transmitting that information and producing proteins). DNA is transcribed into RNA, which is then translated into proteins. This process occurs in all cells.

The statement explains the difference between skin melanocytes and muscle cells is - melanocytes and muscle cells express different genes. So option b  is correct.

Melanocytes are dark, dendritic-shaped, highly differentiated cells that secrete melanin, a pigment found in melanosomes, which is the primary function of melanocytes.

Melanocytes are a type of cell derived from the neural crest. They form a synapse with keratinocytes through their dendrites in the epidermis. Melanocytes play an important part in skin pigmentation and their role in the generation and distribution of melanin has been extensively studied.

To learn more about melanocytes, refer to the link:

https://brainly.com/question/12896990

#SPJ2

A team of zoologists have just completed a study on monkeys in the jungles of Borneo and approach your virology lab to test a panel of monkey sera for the presence of new and known viruses. Because of the remoteness of the study site, they could not maintain a cold chain for their samples so they preserved them in RNAlater - a formulation that destroys protein but preserves RNA intact at ambient temperatures for several days.
After extracting pure RNA from each sample and performing deep sequence analysis (using RNA-Seq) you detect high levels (high viral genome coverage) of 4 RNA viral genomes in 4 different monkey samples. Alignment of these genome sequences with known viral genomes in the public database (GenBank) reveals that you have detected new strains of 4 known monkey viruses belonging to four separate viral groups: a bunyavirus, a rhabdovirus, a picornavirus and a reovirus.
To undertake further phenotypic studies on these viruses you first attempt to culture an isolate of each virus by inoculating a monkey cell line (Vero cells - known to be susceptible and permissive to these viruses) with purified RNA from each of the four virus-positive samples. After testing the inoculated cells 7 days later, it was clear that no isolates were obtained. However, when you transfected the Vero cells with each RNA sample (by treating the cells with a mixture of viral RNA and a lipid formulation that allows nucleic acid to enter the cells), an isolate of the picornavirus was successfully cultured within 5 days. However, no isolates of the other 3 viruses were obtained by this method.
In the context of these results and your knowledge of RNA virus structure and replication, answer the following questions:
a )According to the Baltimore classification system what class of virus do each of these 4 viruses belong to? Describe the essential properties of each different class represented. 
b) Do these viruses contain segmented or unsegmented genomes?
c) What was the likely reason your attempt to isolate virus by inoculating cells was unsuccessful for each virus? 

Answers

Rhabdovirus (Class V), Picornavirus (Class IV), Reovirus (Class III), and Bunyavirus (Class V) belong to different Baltimore virus classes; the likely reason for unsuccessful isolation could be protein destruction by RNAlater or inadequate cold chain storage.

According to the Baltimore classification system, the four RNA viruses belong to different classes. Rhabdovirus is classified as Class V (negative sense RNA virus), Picornavirus as Class IV (positive sense RNA virus), Reovirus as Class III (double-stranded RNA virus), and Bunyavirus as Class V (negative sense RNA virus).

Class III viruses have double-stranded RNA genomes that replicate within the virion and encode an RNA-dependent RNA polymerase. Class IV viruses have positive-sense single-stranded RNA genomes, allowing translation without the need for RNA synthesis. Class V viruses have negative-sense single-stranded RNA genomes, which are transcribed into positive-sense RNA by an RNA-dependent RNA polymerase.

Bunyavirus and Reovirus have segmented genomes, while Picornavirus and Rhabdovirus have unsegmented genomes.

The likely reason for the failure to isolate these viruses by inoculating cells could be attributed to the use of RNAlater, a solution that preserved the RNA samples but destroyed viral proteins. Additionally, the lack of a cold chain during sample storage and transportation may have resulted in protein degradation, leading to unsuccessful isolation.

Learn more about degradation from the given link

https://brainly.com/question/13840139

#SPJ11

give two roles of nucleus in the cell​

Answers

Explanation:

The nucleus controls and regulates the activities of the cell (e.g., growth and metabolism) and carries the genes, structures that contain the hereditary information. Nucleoli are small bodies often seen within the nucleus.

is it ok if u could try and help me with my last question if so thx

1. What processes that occur during meiosis contribute to
genetic diversity in offspring? Select all correct answers.
a. crossing over
b. cytokinesis
c. gametogenesis
d. independent assortment

Answers

A and D because cytokinesis is where a single eukaryotic cell divides into two daughter cells. Gametogenesis is the name given to the process where the cell undergoes meiosis.

human chorionic gonadotropin (hCG)
The hormone produced by cells around the embryo that maintains the corpus luteum and pregnancy is called

Answers

The hormone produced by cells around the embryo that maintains the corpus luteum and pregnancy is called human chorionic gonadotropin (hCG).



Human chorionic gonadotropin (hCG) is a hormone that is produced by cells around the embryo, that is, trophoblastic cells that develop into the placenta, after fertilization. Its main function is to maintain the corpus luteum during the early stages of pregnancy. The corpus luteum is a temporary endocrine structure that develops after the release of an egg from the ovary, that is, after ovulation. It produces progesterone, which is essential for the maintenance of pregnancy in humans.

If an egg is fertilized by a sperm, the resulting embryo secretes hCG, which signals the corpus luteum to continue producing progesterone. This is necessary to prevent the lining of the uterus from shedding and to maintain the pregnancy. If the corpus luteum did not receive this signal, it would degenerate after about 12 days, and progesterone levels would decline. This would cause the lining of the uterus to be shed and menstruation to occur. The levels of hCG in a woman's blood and urine can be used to diagnose pregnancy. hCG levels rise rapidly in the first few weeks of pregnancy and can be detected by a blood or urine test. After about 10 weeks of pregnancy, hCG levels start to decline and eventually level off.

To know more about embryo visit:

https://brainly.com/question/30808880

#SPJ11

Hello, I need help on the blank ones. This is for anatomy and physiology this is for my test tomorrow and it will help a lot if someone helped me with it. Please and thank you :)!!!!!

Hello, I need help on the blank ones. This is for anatomy and physiology this is for my test tomorrow

Answers

Answer:

hihihihihihihi

Explanation:

hihihihuhihihihih

How does implementing green spaces help a city to manage flood damage?(1 point)
A. by increasing the flow of water to drains
B. by absorbing floodwater into soil
C. by rerouting water to streams and rivers
D. by reducing the impact of ocean waves

Answers

I’m not positive but I’d say B

2. Identify the statements below that are true concerning the plasma membrane. The greater the concentration of unsaturated fatty acids, the more fluid the bilayer. b. Phospholipid molecules frequently flip-flop from the inner to the outer layer. Some proteins can drift laterally (side to side) in the fluid lipid bilayer. d. The carbohydrate portions of glycoproteins project internally towards the cytoplasm. Cell membranes are fluid at body temperature (37C) 3. Fill in: Phospholipids have their [1], polar heads facing the intracellular and extracellular fluid. The hydrophobic [2] face each other. Another type of lipid present in the plasma membrane is (3) which stabilizes membrane fluidity. The proteins found in the plasma membrane may be [4]. proteins, which penetrate the membrane, or [5].... proteins, which occur either on the cytoplasmic side or the outer surface side of the membrane. 4. Place a check in the one appropriate column for each statement STATEMENT Isotonic Hypotonic Hypertonie a. The concentration of dissolved substances in the solution is lower than the concentration of substances inside the cell. b. When a cell is placed in this solution, water enters cell c. The concentration of dissolved substances in the solution is the same as the concentration inside cell. d. The concentration of dissolved substances in the solution is higher than the concentration inside cell. e. When this type of solution is injected into the bloodstream, no cell disruption occurs because no net osmosis occurs. f. Putting plant in this solution will result in water loss

Answers

a. [Hypotonic]

b. [Hypotonic]

c. [Isotonic]

d. [Hypertonic]

e. [Isotonic]

f. [Hypertonic]

2. True statements concerning the plasma membrane: a. The greater the concentration of unsaturated fatty acids, the more fluid the bilayer. b. Phospholipid molecules frequently flip-flop from the inner to the outer layer. c. Some proteins can drift laterally (side to side) in the fluid lipid bilayer.

The concentration of unsaturated fatty acids in the plasma membrane directly affects its fluidity. Unsaturated fatty acids have double bonds that introduce kinks in the fatty acid chains, preventing close packing and promoting fluidity. Phospholipid molecules within the bilayer can spontaneously flip-flop between the inner and outer layers. Additionally, proteins in the plasma membrane have the ability to move laterally within the bilayer, allowing for dynamic interactions and functional flexibility.

3. Fill in:

[1] polar heads facing the intracellular and extracellular fluid.

[2] hydrophobic tails face each other.

[3] Cholesterol stabilizes membrane fluidity.

[4] integral proteins, which penetrate the membrane.

[5] peripheral proteins, which occur either on the cytoplasmic side or the outer surface side of the membrane.

Phospholipids in the plasma membrane have their polar heads oriented towards the aqueous intracellular and extracellular environments, while their hydrophobic tails face inward, forming a hydrophobic core. Cholesterol, another type of lipid present in the plasma membrane, helps regulate and stabilize membrane fluidity. Proteins in the plasma membrane can be integral proteins, which span the entire membrane, or peripheral proteins, which are attached to either the cytoplasmic or outer surface of the membrane.

4. Place a check in the appropriate column for each statement:

a. The concentration of dissolved substances in the solution is lower than the concentration of substances inside the cell. [Hypotonic]

b. When a cell is placed in this solution, water enters the cell. [Hypotonic]

c. The concentration of dissolved substances in the solution is the same as the concentration inside the cell. [Isotonic]

d. The concentration of dissolved substances in the solution is higher than the concentration inside the cell. [Hypertonic]

e. When this type of solution is injected into the bloodstream, no cell disruption occurs because no net osmosis occurs. [Isotonic]

f. Putting a plant in this solution will result in water loss. [Hypertonic]

In a hypotonic solution, the concentration of dissolved substances is lower than that inside the cell, causing water to enter the cell by osmosis. An isotonic solution has the same concentration of dissolved substances as the cell, resulting in no net movement of water. In a hypertonic solution, the concentration of dissolved substances is higher than that inside the cell, leading to water loss from the cell.

learn more about "plasma ":- https://brainly.com/question/950535

#SPJ11

A segment of DNA is known to contain the following base sequence:3' GATACCTTTGTGTAGTCATCTT 5'a) Write the mRNA that would be transcribed from this DNA fragment.b) Circle the starter and the stopper in your mRNA sequence. Write the sequence of amino acids which would be encoded in translation. Use the mRNA codon table provided.c) Where in the cell do transcription and translation occur?

A segment of DNA is known to contain the following base sequence:3' GATACCTTTGTGTAGTCATCTT 5'a) Write

Answers

a) In order to transcribe the segment of DNA, it is important to note that this process is important for gene expression as a protein. An enzyme called RNA polymerase moves along the DNA until the end of the gene, releasing the mRNA. The DNA has two strands: one that goes from 5' to 3' direction, and another one that goes from 3' to 5' direction. The one that's used for transcription will always be the 3' to 5' one, so we already have the correct strand to work with, as it is a 3' to 5' strand.

However, the mRNA will be assembled in the 5' to 3' direction. Using the same complementary base-pairing rules as in DNA, we will pair Cytosine (C) with Guanine (G), but as there is no Thymine (T) in RNA, we will pair Adenine (A) with Uracil (U).

Therefore, the sequence o mRNA read in the 5' to 3' direction is:

5' CUAUGGAAACACAUCAGUAGAA 3'

b) The starter codon is the AUG codon of a messenger RNA (mRNA). Therefore, the sequence of amino acids will start to be decoded there.

The stopper codon can be one of the three following options: UAA, UAG or UGA. In this case, we can only find the UAG codon.

The codons, then will be:

AUG GAA ACA CAU CAG UAG

Then, we can say that the amino acids translated will be:

Met Glu Thr His Gln

(Methionine - Glutamine - Threonine - Histidine - Glutamine

c) In eukaryotes, transcription occurs inside the nucleus of the cell and translation occurs in the cytoplasm.

I will give brainliest!!!

Lysosomal storage diseases (LSDs) are a group of rare and inherited genetic disorders in which some part of the lysosome does not function properly, causing the accumulation of toxic substances in the cell and ultimately, cell death.

What would be the most likely explanation as to why the lysosomes of someone with this disease are not functioning properly?

Choose 1 answer:

(Choice A)
A
The enzymes of the lysosome are not breaking down enough toxic material.

(Choice B)
B
The enzymes of the lysosome are beginning to break down the ribosomes of the cell.

(Choice C)
C
The enzymes of the lysosome are breaking down too much toxic material.

(Choice D)
D
The enzymes of the lysosome are beginning to break down the DNA of the cell.

Answers

Answer: The enzymes of the lysosome are not breaking down enough toxic material

Explanation:

What are the types of reproduction? What are the effects of Gonorrhoea on the female reproductive system?

Answers

Answer:

1.) Asexual and sexual

Untreated gonorrhea can lead to Infertility in women and can cause pelvic inflammatory disease. Pelvic Inflammatory Disease (PID) can result in scarring of the tubes, greater risk of pregnancy complications and infertility.

Which of the following molecules provides the code of instructions for the
characteristics of an organism?
A. DNA
B. Protein
C. Lipid
D. ATP

Answers

The answer would be A. The DNA is the molecule that has the instructions needed for an organism to develop.

Hope this helps!! (:
Other Questions
What happened at the Great Leap Forward? What did the Allies accomplish on D-Day? What is the best estimate of the area of the figure on the grid if each square has an area of 4 square inches? Type the correct answer in the box. Use numerals instead of words. If necessary, use / for the fraction bar. Aakash has a fever. His body temperature during the day was 99.2F. By evening, his body temperature has increased by 3.4F. His body temperature in the evening is F. calculate modified duration using the information provided. do not round intermediate calculations. round your answer to two decimal places. use only the data provided in the table above (in the problem statement) for your calculations. Prove that one of the pairs of triangles is congruent BE2-10 At December 31, balances in Manufacturing Overhead are Shimeca Company- d. debit $1,200, Garcia Company-credit $900. Prepare the adjusting entry for each com- pany at December 31, assuming the adjustment is made to cost of goods sold. how was earth created ? facility planning entails asking crucial questions, including all of the following except how much total capacity is needed? how much capacity does the competition have? where should facilities be located? when is the capacity needed? typically, in order to get people to the polls, which of the following is generally employed? Which sentence describes part of a story's setting?A) A little girl walked slowly up the steps to the porch.B) When the train arrived, only two people left it.C) The blue bottle slipped to the floor and shattered.D) Inside the room was a large table with mismatched chairs. Mamadou is flying a kite, holding his hands a distance of 2.75 feet above the ground and letting all the kites string play out. He measures the angle of elevation from his hand to the kite to be 27 . If the string from the kite to his hand is 75 feet long, how many feet is the kite above the ground? Round your answer to the nearest tenth of a foot if necessary. Insert one dash where needed.Ms. Christensen studied both business and fine arts in college a combinationthat makes sense to those who know her as the owner of a highly successfulart supply store. The number of the amendment that gives Americans freedom of speech and religion isa#1b#3#8#2 Don Draper has signed a contract that will pay him $80,000 at the end of each year for the next 6 years, plus an additional $100,000 at the end of year 6. If 8 percent is the appropriate discount rate, what is the present value of this contract? a. What is the present value of $80,000 at the end of each year for the next 6 years if the discount rate is 8 percent? how can state government shape public policy?A.by using direct democracy procedures to forcibly change federal policies B.by creating and enforcing laws that the states unique priorities C.by adopting state constitutions to replace the rules in the U.S constitution D.be exercising the supremacy clause to refuse to obey unpopular federal laws A neon sign blinks every 6 minutes, and another sign blinks every 8 minutes. How often do they blink at the same time?A.Every 14 minutesb.Every 24 minutesc.Every 48 minutesd.Every 2 minutes Read the following passage. Then tell which statement is true. Ronti was an unusual elf. He was bigger than most elves, and he wore his hat at a strange angle. He was always humming human songs, and unlike other elves, he enjoyed swimming. What made Ronti really different, however, was his ears. They were rounded, not pointy! The other elves had never seen anything like it before.A) The passage does not tell the setting of the story.B) The passage does not mention any characters in the story.C) The passage is most likely from a drama.D) The passage does not have any supporting ideas. what is an advantage of using a raw materials subsidiary ledger? Veronica spent a minimum of $65 on a doll and accessories for the doll. The doll cost $26 and the accessories cost $13 each. Write an inequality can be used to find the possible values for x, the number of doll accessories Veronica could have bought.