History: Who was the first president?

Answers

Answer 1

The first president of the United States is President George Washington.

Hope this helped!!


Related Questions

Perhaps the biggest difference, then, is that progressives believe in, and work towards, equality, whereas populist authoritarians actively work ...

Answers

The biggest difference between progressives and populist authoritarians is their approach to equality. Progressives firmly believe in the concept of equality and actively work towards achieving it. They recognize that there are deep-rooted systemic issues in our society that have created disparities in wealth, opportunity, and power, and they work tirelessly to address these issues.

Populist authoritarians tend to have a more divisive and exclusionary approach to politics. They often scapegoat certain groups or individuals for societal problems, rather than addressing the root causes. In doing so, they perpetuate inequality and reinforce existing power structures.


The key distinction between progressives and populist authoritarians lies in their approach to equality. Progressives focus on promoting equality through policies and social reforms, while populist authoritarians typically pursue policies that maintain or exacerbate social and economic inequalities.

To know more about populist visit:-

https://brainly.com/question/31782017

#SPJ11

Emerald bout 50 pineapples at 50coins each and sold the for $31. 0. Calculate the profit on the 50 pineapples

Answers

Emerald's profit on the 50 pineapples can be calculated by subtracting the total cost of purchasing the pineapples from the total revenue generated from their sale.

To calculate the profit on the 50 pineapples, we need to determine the total cost and the total revenue. Emerald bought 50 pineapples at a cost of 50 coins each, resulting in a total cost of 50 coins x 50 pineapples = 2500 coins.

Emerald then sold the pineapples for $31.00. Since the currency is not specified, let's assume it is in dollars. Therefore, the total revenue from the sale of the pineapples is $31.00.

To calculate the profit, we subtract the total cost from the total revenue: $31.00 - $2500 = -$2469.00.

The negative value indicates a loss rather than a profit. In this case, Emerald incurred a loss of $2469.00 on the 50 pineapples.

It's important to note that the profitability of the transaction depends on various factors such as the initial cost of the pineapples, additional expenses (e.g., transportation, packaging), and the selling price. Without more information, we can only calculate the profit/loss based on the given figures.

Learn more about revenue here :

#SPJ11

The profit on the 50 pineapples is $6.00.Emerald bout 50 pineapples at 50coins each and sold the for $31. 0.

To calculate the profit on the 50 pineapples, we need to determine the total cost of purchasing the pineapples and subtract it from the total revenue generated from selling them.

given:

number of pineapples bought: 50

cost of each pineapple: 50 coins

total revenue from selling: $31.00

step 1: calculate the total cost of purchasing the pineapples:

total cost = number of pineapples bought * cost of each pineapple

total cost = 50 * 50 coins

step 2: convert the cost to dollars:

total cost in dollars = (total cost in coins) / (exchange rate from coins to dollars)

note: the exchange rate is not provided in the given information, so we'll assume an exchange rate of 1 coin = $0.01 (1 cent).

total cost in dollars = (50 * 50 coins) * ($0.01/coin)

step 3: calculate the profit:

profit = total revenue - total cost in dollars

profit = $31.00 - total cost in dollars

let's calculate the total cost in dollars first:

total cost in dollars = (50 * 50 coins) * ($0.01/coin)

total cost in dollars = 2500 coins * $0.01/coin

total cost in dollars = $25.00

now, calculate the profit:

profit = $31.00 - $25.00

profit = $6.00

Learn more about revenue here:

https://brainly.com/question/14952769

#SPJ11

FAST PLEASE IM IN TEST
How did violent outbreaks such as the Haymarket Riot and Homestead Strike affect the labor movement?
O They resulted in the decreased membership of labor unions.
O They resulted in a rise in socialist and anarchist movements.
O They resulted in an increase in public approval of organized labor.
O They resulted in a desire to seek new markets and raw materials in the West.​

FAST PLEASE IM IN TESTHow did violent outbreaks such as the Haymarket Riot and Homestead Strike affect

Answers

Answer: B - rise in sociaist

Question - r u taking them pma

The violent outbreaks such as the Haymarket Riot and Homestead Strike affect the labor movement as They resulted in a rise in socialist and anarchist movements Option(b) is correct.

What does Anarchism means?

Anarchism is a political way of thinking and development that has some serious misgivings of all supports for power and looks to nullify the establishments.

People lived in social orders without formal progressive systems well before the foundation of formal states, domains, or realms. With the ascent of coordinated various leveled bodies, suspicion toward power additionally rose.

Despite the fact that hints of revolutionary idea are found since the beginning of time, current anarchism rose up out of the Edification. During the last 50% of the nineteenth and the main many years of the twentieth hundred years, the rebel development prospered in many regions of the planet and played a huge part in laborers' battles for liberation.

Therefore Option(b) is correct.

Learn more about Anarchism here:

brainly.com/question/9266780

#SPJ2

Can you identify any injustices still evident in the world to-day? What injustices would you risk getting arrested to stop?

Answers

Numerous injustices persist, including systemic racism, gender inequality, economic disparities, human rights abuses, environmental degradation, and political oppression. These injustices manifest in various forms and affect different communities worldwide. For example, racial discrimination continues to marginalize and disadvantage minority groups, with disparities in areas such as education, employment, and criminal justice. Gender inequality persists in many societies, leading to unequal access to opportunities, violence against women, and limited reproductive rights.

Human rights abuses occur in numerous regions, including violations of freedom of speech, assembly, and expression, as well as infringements on privacy and the right to a fair trial. Economic inequalities remain stark, with a significant portion of the global population living in poverty, lacking access to basic needs such as healthcare, education, and clean water.

Environmental injustices are also prominent, with marginalized communities disproportionately bearing the brunt of pollution, climate change, and resource exploitation. Political oppression, censorship, and restricted freedoms curtail democratic processes and limit citizens' ability to express their opinions or participate fully in society.

While addressing these injustices is crucial, it is important to pursue change through legal and peaceful means. Civil disobedience, while historically associated with some movements, carries legal consequences and should be undertaken thoughtfully and responsibly. Instead, individuals and communities can engage in activism, advocacy, education, and support organizations and initiatives working towards justice and equality.

Ultimately, the fight against injustices requires collective effort, public awareness, policy changes, and sustained commitment to creating a more equitable and just world for all.

for more questions on injustices  

https://brainly.com/question/28780655

#SPJ8

What events involving Aaron Burr clouded Jefferson's second term as president?

Answers

Answer:

Aaron Burr broke faith with Jefferson, and hatched various schemes with dissident Federalists. He ran for governor of New York in 1804 and enlisted Federalist support, which was blocked by Alexander Hamilton. Burr lost, and challenged Hamilton to a duel and killed him. Charged with murder, Burr fled to the West and launched possibly treasonous expedition against the United States involving invasion of Spanish territory and the turning over of territory to great Britain. He perhaps had in mind to create an independent Republic of Louisiana Republic with himself as President, though the details remain cloudy.

During Burr's treason trial Chief Justice John Marshall ruled that the Court must follow very strict Constitutional criteria for conviction of treason; thus he disallowed circumstantial evidence, and Burr went free. Marshall's precedent made it difficult for later presidents to use the charge of treason to threaten opponents for political purposes.

Explanation:

hoped this helped! <3 A brainiest is always appreciated! if this helped give a thanks and rating, i always try to reply to comments! have a nice day :)

Warm up

1 - Do politicians lie? explain

2 - Should politicians be held accountable for lying? Are they?

3- Should there be term limits?

Answers

1) Politicians, like any human, do lie. However, politicians are put in a position where what they say (and in turn, their actions) may have higher consequences towards not only the country but also the population. Brainly doesn't allow too political of a talk, but one only has to see recent statements by many our politicians to see "Mostly false" to "false" statements.

2) Politicians should be held to at least the same standard as any ordinary citizen, but they have even more restrictions, as what they say in their jobs have more impact then the average citizen who lies. The second part of the question is extremely dependent on the relationship between the major news networks and political figures as well as whether or not their views align. Politicians may be held accountable by news sources that align on the opposite end of the political spectrum, but it is really dependent on the news source. Essentially you can answer it as:

Should they be held accountable? Of course.

Are they? Depends.

3) There should always be term limits, particularly because many of our politicians are more older. The current term limits are balanced as it is, but there should be more regulations in place to ensure that our politicians have the mental capacity to be able to run our country. Term limits, for a historical perspective, just ensures that the country would stay as a republic, and would not become a totalitarian regime.

~

Learn more about our political system, here:

https://brainly.com/question/8845250

_____ caused the Americans to not continue to attack the British outside of Philadelphia after the British retreated for the first time.

Starvation
Lack of confidence
Weather
Fear

Answers

Answer:

The Americans stopped attacking the British outside of Philadelphia after they retreated for the first time because of the weather.

It was winter, and whereas the British were warm and cozy, whereas those Americans who still wanted to fight were frozen and deprived of food and resources. Thus they decided to wait until the weather cleared and then attack their enemies.

Explanation:

Answer:

Because Weather

Explanation:

Why might a new town develop close to a factory

Answers

Answer:

Because where there is industry there is the opportunity of future business and economic growth.

Explanation:

Because it makes combing community and publicity

(q005) as a result of this 1971 supreme court case, judges throughout the country ordered the use of busing as a tool to achieve school integration.

Answers

The 1971 Supreme Court case resulted in judges ordering the use of busing as a tool to achieve school integration throughout the country.

The Supreme Court's ruling in Swann v. Charlotte-Mecklenburg Board of Education affirmed the principle that remedial measures, including busing, could be necessary to overcome the effects of past segregation and achieve meaningful school integration. The Court held that federal courts had the authority to order busing as a remedy when necessary to eliminate the vestiges of segregation and achieve genuine racial balance in public schools.

The decision had wide-ranging implications as it provided a legal basis for judges throughout the country to order the use of busing as a means of achieving school integration. In subsequent years, many school districts across the United States were required to implement busing as part of their desegregation efforts, especially in areas where racially segregated schools persisted.

Learn more about Supreme Court here:https://brainly.com/question/18228641

#SPJ11

Which civilization was a part of the Trans-Saharan Trade Network? *

Answers

Answer:

Soninke empire of Ghana

Explanation:

What is truce of god?

Answers

Answer:

A measure of medieval Roman Catholic Church to suspend warfare during certain days of the week and during period of certain church festivals and lent

Explanation:

This truce for is fighting on Sunday's and feria.

what does 2,4,6, and life all have in common (it has something to do with civics)

Answers

Answer:

it is all apart of life

Explanation:

I don't really understand it or have much of an explanation

Economics
Government
Social
Relationships
Law
Jewish Ten
Commandments
Followers of
Judaism were
required to tallor
their governments
to fit God's
commandments.
They could not
obey any
government that
required them to
break a
commandment
Code of
Hammurabi
Facing Mount
Kenya
In Babylon, a
person's status as
free or a slave
determined how
other people were
allowed to treat
him.

EconomicsGovernmentSocialRelationshipsLawJewish TenCommandmentsFollowers ofJudaism wererequired to tallortheir

Answers

Answer:10

10

Explanation:


When you buy a U.S. government savings bond, you're doing so under the power given to Congress to

Answers

When you buy a U.S. government savings bond, you're doing so under the power given to Congress to borrow money.

What is U.S government savings bond?

U.S government savings bonds occur when an investor buys a saving bonds in which buying the saving bonds implies that the investor lend out money to the U.S government.

In which the  U.S government will then promise to pay back the money to the buyer  including the interest on the amount loan to the government.

Therefore the word that complete the statement is  borrow money.

Learn more about U.S government savings bonds here:

https://brainly.com/question/379784

#SPJ1

What was the unofficial ratio of churches-to-saloons that Riis roughly counted in NYC?

Answers

Jacob Riis, a journalist and social reformer, documented the living conditions of New York City's tenements in the late 19th century. In his book, "How the Other Half Lives," Riis noted that in the areas he surveyed, there was approximately "one church for every five saloons." This ratio became known as the "unofficial ratio" of churches-to-saloons in New York City.

Riis was critical of the abundance of saloons in impoverished areas and their adverse effects on the community, including increased poverty, crime, and alcoholism. He argued that more churches were needed to influence and support residents positively.

While Riis' calculations may have been vague, his documentation shed light on the disparities and issues facing urban areas in the late 1800s. Today, the ratio of churches-to-saloons is likely different in New York City. Still, community support and positive influences remain crucial for improving living conditions and reducing social issues.

To learn more about Jacob Riis, visit: https://brainly.com/question/7943237

#SPJ11

what were the comstock laws attempting to prevent?

Answers

The Comstock Laws were a series of federal statutes enacted in the United States in the late 19th and early 20th centuries that were designed to prevent the distribution of obscene materials.

R: The laws were named after Anthony Comstock, a social reformer and special agent of the U.S. Post Office who was instrumental in their creation.A: Comstock and his supporters believed that obscene materials were morally corrupting and posed a threat to public health and safety.C: The Comstock Laws made it illegal to send or receive materials deemed obscene through the U.S. mail, and also prohibited the sale or distribution of such materials within the United States.E: The Comstock Laws were controversial and faced significant opposition from advocates of free speech and reproductive rights. Over time, the laws were challenged and revised, and some of their provisions were struck down as unconstitutional. Nevertheless, the legacy of the Comstock Laws continued to influence debates over obscenity and censorship in the United States throughout the 20th century.

To learn more about Comstock Laws click the link below:

brainly.com/question/901768

#SPJ4

How did people travel from Halifax to the west coast in the 1850s? Why? (Why was it hard to travel from Halifax to Vancouver?) PLS HELP!!

Answers

Answer:

just go to safari

Explanation:

it's correct :))

Drawing upon ideas from the Articles of Confederation, the _______________ called for a one-house legislature in which each state, regardless of size, would have one vote. i need help!!

Answers

Answer: New Jersey Plan

Explanation:

The guy on the top is right

Which physical feature contains one of the busiest ports in the nation for oceangoing container ships? *

Answers

The physical feature that contains one of the busiest ports in the nation for oceangoing container ships is the Los Angeles Harbor. It is located in San Pedro Bay, which is a natural harbor located in Southern California.

The Los Angeles Harbor is known for its efficient and well-managed operations, and it is capable of handling massive cargo ships that carry a wide variety of goods from all over the world. With its strategic location, modern infrastructure, and advanced technologies, the Los Angeles Harbor has become a vital gateway for trade and commerce, connecting the United States to the global economy. The physical feature that contains one of the busiest ports in the nation for oceangoing container ships is the San Pedro Bay in Southern California. This bay is home to the Port of Los Angeles and the adjacent Port of Long Beach. Together, they form a vital gateway for international trade, handling a large volume of cargo and accommodating numerous container ships daily. The strategic location, well-developed infrastructure, and efficient operations at these ports contribute to their status as essential hubs in the global supply chain and commerce.

To know more about busiest ports visit:

https://brainly.com/question/23285008

#SPJ11

civil rights act 1866 political events

Answers

Answer:

What type of statistical question is this

Compare and contrast The Portrait of a Lady with Washington Square.
How these two works show the problems concerning American women as they strive to establish their independence in a society and a time dominated by men ?

Answers

"The Portrait of a Lady" and "Washington Square" both explore the themes of love, marriage, and societal expectations, but differ in terms of their protagonist's agency and outcomes. It depict the struggles of American women for independence in patriarchal society, showcasing the challenges, limitations, and societal pressures they face.

In The Portrait of a Lady, written by Henry James, the protagonist, Isabel Archer, seeks personal freedom and self-realization. However, her aspirations are hindered by societal expectations and the manipulation of male characters. Isabel's struggle highlights the constraints placed on women and the limited options available to them, emphasizing the difficulties of establishing independence.

In contrast, Washington Square, also by Henry James, portrays Catherine Sloper, a young woman trapped in a stifling environment controlled by her father. Catherine's path to independence is obstructed by her father's dominance and societal conventions. The novel explores the constraints placed on women by family dynamics and societal pressures, presenting the challenges faced by women in asserting their own desires and choices.

Both works showcase the plight of American women in a time dominated by men, illustrating the limitations imposed on their autonomy, choices, and agency, emphasizing the struggle for independence in a patriarchal society.

To know more about The Portrait of a Lady, click here.

https://brainly.com/question/30389128

#SPJ4

What did unions want for America? Have they done anything for your family?

Answers

Unions in America have historically sought to achieve several goals that benefit workers and society as a whole. Some common objectives pursued by unions include:

1. Improved Working Conditions: Unions aim to secure better working conditions for their members, such as fair wages, reasonable working hours, safer workplaces, and protections against workplace hazards.

2. Fair Wages and Benefits: Unions advocate for fair wages and benefits, including healthcare coverage, retirement plans, paid leave, and other employee benefits. They strive to negotiate collective bargaining agreements that ensure workers receive just compensation for their labor.

3. Job Security: Unions work to protect workers from arbitrary termination or unfair dismissal by establishing grievance procedures and advocating for job security provisions in employment contracts.

4. Workplace Democracy: Unions promote workplace democracy by giving workers a collective voice in decision-making processes that affect their working conditions, job roles, and employment terms.

5. Social and Economic Justice: Unions often advocate for broader social and economic justice issues, such as advocating for equal rights, fighting against discrimination and inequality, and supporting policies that benefit workers and their communities.

Regarding the impact on individual families, the influence of unions can vary. For many unionized families, unions have played a crucial role in securing better wages, benefits, and working conditions, improving overall financial stability and quality of life. Unions have helped negotiate contracts that provide job security, access to healthcare, retirement benefits, and other essential protections. However, the specific benefits experienced by families can depend on factors such as the industry, occupation, and individual circumstances.

It's important to note that the impact of unions extends beyond individual families. Unions have played a significant role in shaping labor laws, social policies, and workplace standards that benefit workers across the board, even those not directly affiliated with a union. Through collective bargaining, advocacy efforts, and political engagement, unions have made contributions to broader societal advancements in workers' rights and social justice.

Ultimately, the impact of unions can vary, and it is important to consider the specific experiences and circumstances of individuals and families when evaluating their benefits.

For more such answers on America

https://brainly.com/question/28994954

#SPJ8

How was H.H. Holmes caught?

Answers

Holmes was eventually caught in 1894, after he was arrested for fraud and insurance fraud. He had taken out a life insurance policy on a man named Benjamin Pitezel, who he had killed and dismembered, and then tried to collect the insurance money. Pitezel's family had grown suspicious and contacted the police.

H.H. Holmes, also known as Herman Webster Mudgett, was a notorious serial killer who lived in the late 19th century. He is believed to have killed as many as 200 people, primarily through his "murder castle," a large building he constructed in Chicago that contained elaborate traps and torture devices.

During the investigation, police discovered that Pitezel was not the only victim of Holmes and that he had used his murder castle to kill and dispose of multiple victims. Holmes was arrested and charged with several counts of murder.

During his trial, Holmes confessed to 27 murders, but it is believed that the true number of his victims could be over 200. He was found guilty and sentenced to death by hanging in 1896.

It is worth mentioning that the investigation and trial of H.H. Holmes was a major media sensation at the time, with newspapers across the country following the case closely. The case helped to establish the modern concept of the "serial killer" and inspired a number of fictional depictions of Holmes in literature and film.

To know more about H.H. Holmes refer to-

brainly.com/question/10938478#

#SPJ11

what was the most common state-administered punishment in 5th century roman civilization?

Answers

The most common state-administered punishment in 5th century Roman civilization was crucifixion. This brutal form of execution involved nailing or binding the condemned individual to a wooden cross and leaving them to die of asphyxiation, blood loss, or exposure.

Crucifixion was a particularly cruel and degrading punishment, reserved for the worst offenses such as rebellion, treason, or grave crimes against the state.

The practice of crucifixion was not unique to the Roman Empire but was widely used throughout the ancient world as a means of social control and deterrence. However, the Romans perfected the technique and turned it into a spectacle that was intended to intimidate and terrorize the populace. Crucifixions were often carried out in public places, such as roadsides or city gates, where they could be easily seen and serve as a warning to others who might contemplate challenging Roman authority.While crucifixion was the most common state-administered punishment in 5th century Roman civilization, it eventually fell out of favor as the empire became Christianized and more humane forms of punishment were introduced. Today, crucifixion is universally condemned as a barbaric and inhumane practice, and its legacy serves as a reminder of the brutality and cruelty that can be inflicted upon others in the name of justice and power.

Know more about the 5th century Roman civilization

https://brainly.com/question/27986447

#SPJ11

one similarity between the Six-Day War and the Yom Kippur War?


Answers

Answer:

Both were examples of Arab-Israeli conflicts in the twenthieth century


What is the relationship between central and regional authorities like
under federalism?*
A.Power is concentrated in the central authority,
B.Power is concentrated the regional authorities.
C.The central and regional authorities have their own powers, but share power when necessary
D.The central and regional authorities are completely independent of each other

Answers

Answer:

C. The central and regional authorities have their own powers, but share power when necessary

Explanation:

In federalism, regional authorities were given with independence to control each of their own territories. Regional leaders will be able to create laws and legislations to fully reach their regions' potentials and to address the social issues that specifically exist in their region.

The central authorities will play the role as a regulator. They determine the contribution that each regions need to made to fund activities that will benefit the nation as a whole. They also will handle the conflicts that potentially occurred between regions,.

The 1920s saw a rise in anti-immigration sentiment. How would you explain the widespread popularity of the anti-immigration position?

Answers

Answer:

The increase in immigrants looking for a job was one of the major factors that stimulated the feeling of anti-immigration with American society.

Explanation:

As a result of intense industrialization in 1920, the USA received a very large increase in the number of immigrants trying to enter the country in search of a better life and a more profitable job. This increase in immigrants generated a strong sense of anti-immigration among the American population, who believed that immigrants were entering the country to steal American jobs, occupy American residences and spread disease to hamper the country's success.

In other words, we can say that the increase in the number of immigrants was what projected the increase in the feeling of anti-immigration.

The 1920s saw a rise in anti-immigration sentiment.

The reason for immigration in America has been different as some came to escape from poverty, war, debt, practice religion, etc.During the 1920s, America was fearful of communist and radical politics.There was an increasing anti-immigration sentiment among Americans as they became fearful of securing their jobs.The immigration act of 1924 limited the number of immigrants coming into the United States. The Ku Klax Klan also emerged in the South as they showed their anti-immigration sentiment.

Therefore we can conclude that the 1920s was a period when America was changing in many different ways socially, politically and economically.

Learn More about "anti-immigration" here:

brainly.com/question/269529

Explain how sharecropping exploited former slaves

Answers

Answer:

jesus is always the answer

Explanation:

in highly collectivist countries such as south korea and japan, success tends to be measured by the success of the group rather than by individual achievements and performances.

Answers

In highly collectivist countries such as South Korea and Japan, success is indeed often measured by the success of the group rather than individual achievements and performances.

How is success measured in highly collectivist countries?

In these societies, there is a strong emphasis on interdependence and harmony within the group. The collective is prioritized over individual interests, and individuals are encouraged to work together towards common goals. This collectivist mindset extends to various aspects of life, including education, work, and social relationships.

Success is often viewed as the result of one's contributions to the group and the ability to fulfill societal expectations and responsibilities. Personal achievements and performances are seen as a reflection of the group's collective efforts and are celebrated as such.

In education, for example, students are encouraged to study hard not only for personal gain but also for the honor and reputation of their families and communities. In the workplace, loyalty and dedication to the organization are highly valued, and promotions are often based on seniority and the ability to contribute to the overall success of the company.

By valuing group achievements, collectivist societies foster a sense of unity, cooperation, and social cohesion. However, it's important to note that individual accomplishments are still recognized and valued, but within the context of their contributions to the group.

To learn more about collectivism, visit

brainly.com/question/30766231

#SPJ11

can someone please help me with this question for my history assessment!

Some activist have called for a _______ of any business that does not explicitly oppose the law
a. Boycott
b. Brigade
c. Backlog
d. Protest

Answers

Answer:

a. Boycott

Explanation:

Other Questions
Which type of impact relating to MVCs would offer the least protection to the passenger? A. Rear B. Front C. Top D. Sides Sumy is working in geometry class and is given figure ABCD in the coordinate plane to reflect. The coordinates of point D are (a, b) and she reflects the figure over the line y = x. What are the coordinates of the image D'?(a, b)(b, a)(a, b)(b, a) they are made out of meat Throughout the story, the aliens constantly refer to "meat" with a negative view. What doesmeat represent in this story? Why do you think the author chose "meat" for thisrepresentation? Four ways in which your choice of reading material can affect your writing - Sentence Writing (23W) tempt 1 Questo p A student's assignment asked, What is the purpose of "I Bonded With a Robot"? The student answered, "Encouraging readers to become comfortable with the idea of chatbots contributing to mental health care." Unfortunately, their answer contains a sentence fragment. In the space provided, write a corrected version of the student's answer. How does the author uses structure to convey Dexter determination to succeed Order the set of numbers from least to greatest? A scientist mixes water (containing no salt) with a solution that contains 30% salt. She wants to obtain 210 ounces of a mixture that is 20% salt. How many ounces of water and how many ounces of the 30% salt solution should she use? Can someone find The volume of the shaded portion of the cylinder??????????????????????? I have attached the picture I need help with my math homework the supreme court has most recently ruled that what happens between consenting adults: What is an observational source? A. an experience you have personally through your five senses B. a person you talk to or interview C. a source you find online D. a source you find in a database IEvaluate 4x+y when x=5/4 and y=1/5. Write your answer as a mixed number in simplest form. Individuals dealing with psychological problems related to being unemployed would mostly likely seek assistance to find a job from a The farm bill that passed the U.S. Congress in 2007 contained subsidies of $289 billion for the next 10 years. This is an example of Multiple Choice an ad valorem tariff. 0 a specific tariff. 0 a subsidy a government bailout. Prev 1015 H Next > Help I'm confused!This is the beginning sequence of the first exon in the mRNA sequence:AUGAAGCUCUUUUGGUUGCUUUUCACCAUUGive the DNA/genomic sequence it was transcribed from. Which claim does the author's use of false dilemmasupport?O People who live in small towns are strugglingfinanciallyO Consumers are going to big-box stores instead offarmer's markets.O Farmer's markets provide financial support to localbusinesses.O Local support for community businesses is a thing ofthe past. A piece of plastic is uniformly charged with surface charge density n1. 1. The plastic is then broken into a large piece with surface charge density n2. 2. A small piece with surface charge density n3 3. Rank in order, from largest to smallest, the surface charge densities n1 to n3.A. n1>n2>n3.B. n1>n2=n3.C. n1=n2=n3.D. n2=n3>n1.E. n3>n2>n1. The value of Investment A at the end of year 5 is $20,000. Assuming that interest is compounded annually, and the interest rate is 8%, what is the present value of this investment at the beginning of year 1 Richard spent $95 on hockey tickets, while Dennis spent $57. If all the tickets were the same price, what was the price of one ticket? SHOW YOUR WORK