Including human existence, depend on biodiversity. Without a wide range of organisms, including animals, plants, and microorganisms, our ecosystems cannot be healthy.
Why is biodiversity important? What is it?In the context of our world, the term "biodiversity" refers to the variety of all the different species of living things, including all the different types of plants, animals, insects, and microorganisms. Each of these organisms coexists with others in ecosystems in order to sustain and support life on earth.
What are the two advantages of preserving biodiversity?Maintaining genetic diversity supports the survival of a variety of crops that may be disease-resistant and possibly beneficial biochemicals, such as those used in medicine. It also refers to the species' accessibility.
To know more about biodiversity visit:-
https://brainly.com/question/13073382
#SPJ1
what is the backbone of RNA made out of?
Answer:
Explanation:
It has a deoxyribose and phosphate backbone having four distinct bases: thymine, adenine, cytosine, and guanine. Is a polymer with a ribose and phosphate backbone with four varying bases: uracil, cytosine, adenine, and guanine.
Which type of mutation affects the largest number of genes? A. Missense mutation B. Silent mutation C. Point mutation D. Chromosomal mutation
Answer is: Chromosomal mutation
Is 7 a domain or range?
The domain of y=7 is \(\mathbb{R}\). And, the range is [7,7]. So 7 is both range and domain.
The domain of a function is the variety of values that can be inserted into it. A function's range is the collection of possible values that it can take on its own. A logarithmic function's domain is all real numbers greater than zero, and its range is all real values.
Given that y=7. Here, the number 7 is a real number and this number is greater than zero. Therefore, all the real number is considered as the domain i.e., \(\mathbb{R}\) is domain and the range is {7}=[7,7].
To know more about the domain:
https://brainly.com/question/9832306
#SPJ4
What is the function of the enzyme topoisomerase in DNA replication? (A) relieving strain in the DNA ahead of the replication fork caused by the untwisting of the double helix (B) elongating new DNA at a replication fork by adding nucleotides to the existing chain (C) reattaching the hydrogen bonds between the base pairs in the double helix (D) building RNA primers using the parental DNA strand as a template
The function of the enzyme topoisomerase in DNA replication is relieving strain in the DNA ahead of the replication fork caused by the untwisting of the double helix.
Nuclear enzymes known as topoisomerases are crucial for DNA replication, transcription, chromosome segregation, and recombination. These enzymes come in two main varieties; type I enzymes pass one or two DNA strands through the break before sealing it, whereas type II molecules cleave both DNA strands simultaneously and religate the double-strand break after passing another double strand through the break. By splitting, swiveling, and reconnecting DNA strands, a topoisomerase corrects "overwinding" before replication forks. This enzyme, to put it simply, stops the DNA double helix before the replication fork from becoming too wrapped as the DNA is opened up. Therefore, this enzyme stops DNA from supercoiling.
To learn more about topoisomerase and replication fork here,
https://brainly.com/question/16249394
#SPJ4
Organelles called plastids are found in
Answer:
fHay dos tipos de plastos claramented diferenciados, según la estructura de sus membranas: los plastos primarios, que se encuentran en la mayoría de las plantas y algas; y plastos secundarios, más complejos, que se encuentran en el plancton
Explanation:
Over a long period of time, the
average temperature and
precipitation
of an area is called
A. regional pressure
B. climate
C. temperate
Answer:
B climate
Explanation:
Climate means over a long period of time like years, months, decades, and centuries, but tempurature is only for a few hours, minutes or days.
Answer: Justice.
Explanation: The Answers Justice.
you recently discovered a new photosynthetic bacterial cell. based on your knowledge of prokaryotes, what else should be present in the cell?
newly discovered photosynthetic bacterial cell, and considering the knowledge of prokaryotes, the following components should also be present in the cell:
1. Cell wall: A rigid structure surrounding the cell membrane, providing protection and support.
2. Plasma membrane: A semi-permeable barrier that controls the movement of substances in and out of the cell.
3. Cytoplasm: The jelly-like substance inside the cell where various metabolic reactions occur.
4. Ribosomes: The structures responsible for protein synthesis.
5. Nucleoid region: The region containing the bacterial cell's genetic material, such as circular DNA.
In summary, a newly discovered photosynthetic bacterial cell should have a cell wall, plasma membrane, cytoplasm, ribosomes, and a nucleoid region, based on our knowledge of prokaryotes.
To know more about cell visit :-
https://brainly.com/question/13920046
#SPJ11
Pathogens, like disease causing viruses, can enter the body through the blood stream. Phagocytic white blood cells will respond by releasing enzymes and by ingesting the pathogens to destroy them. What transport process is used by these white blood cells to ingest the virus?
A) facilitated diffusion
B) sodium-potassium pump
C) exocytosis
D) endocytosis
Answer:
did u ever find out what the answer was??
Explanation:
1. Riparian vegetation limits meandering, causing downcutting and a reduced water table.
True / False
2. A guild is a fish feeding classification based on where they reproduce in water column
True / False
3. A primary producer is defined as a living organism such as algae that can convert nutrients, carbon dioxide, water and energy from the sun into living matter.
True / False
4. In riparian areas, soil acts like a sponge to retain water .
True / False
5. Feeding relationships of organisms determine the pathways of energy flow through the aquatic system
True / False
6. The total area drained by a stream or river is called a:
a) landscape
b) catchment
c) riparian zone
d) hydrologic cycle
7. Benthic refers to the assemblage of organisms inhabiting the bottoms of streams, lakes, and ocean.
True / False
The statement is true. Riparian vegetation limits meandering, causing downcutting and a reduced water table. In areas where vegetation has been removed, the riverbank may be eroded due to increased water flow. The given statement is false. A guild is a fish feeding classification based on the type of food they eat.
The given statement is true. A primary producer is defined as a living organism such as algae that can convert nutrients, carbon dioxide, water and energy from the sun into living matter. The given statement is true. In riparian areas, soil acts like a sponge to retain water. Riparian vegetation can help to increase soil permeability, which in turn helps to reduce the speed of water flow and prevent soil erosion. The given statement is true. Feeding relationships of organisms determine the pathways of energy flow through the aquatic system.
Organisms in the lower trophic levels are eaten by those in the higher trophic levels. This process continues until the top predator in the food chain is reached. The total area drained by a stream or river is called a catchment. The catchment includes all the water that flows into the stream or river, including surface runoff, subsurface flow, and groundwater. The given statement is true. Benthic refers to the assemblage of organisms inhabiting the bottoms of streams, lakes, and ocean.
To know more about vegetation visit:
https://brainly.com/question/28405832
#SPJ11
what tool is used to determine the precise location of radioactively labeled DNA
What is the difference between DNA content and chromosomes number, thanks
Answer:
I have been to get a
Explanation:
I c have a true conclusion for my head but I think it is a good way for me to get
¿de que manera el desarrollo cientifico y tecnologico repercute en la agricultura ecologica ,como parte de las condiciones para la propuesta de emprendimiento familiar?
Answer:
Los desarrollos científico-tecnológicos han impactado positivamente sobre los sistemas de agricultura ecológica y en última instancia también sobre la agricultura familiar
Explanation:
La agricultura ecológica refiere a los procedimientos de explotación agrícola basados en la utilización sustentable de los recursos de la tierra y los métodos de fertilización orgánica, respetando el ambiente natural y evitando el uso de compuestos químicos artificiales (como por ejemplo plaguicidas químicos) y de cultivos transgénicos. Por otra parte, la agricultura familiar refiere a un tipo de agricultura ecológica basado en la dirección y la administración familiar. La agricultura familiar es el sistema de agricultura predominante en regiones pobres de América Latina y el Caribe, representando aproximadamente el 80 % de la producción agrícola. De este modo, el desarrollo de métodos eficientes de agricultura/ecológica familiar resultan fundamentales para lograr la seguridad alimentaria en la región y también para mitigar los efectos negativos del cambio climático. En este contexto, diferentes avances científico-tecnológicos han impactado positivamente sobre el manejo, eficiencia y productividad de la agricultura familiar como sistema de cultivo no sólo sustentable sino también eficiente, entre los cuales se destacan el desarrollo de mini-invernaderos, variedades mejoradas obtenidas a través de técnicas de mejoramiento genético convencional (selección a campo), trampas artesanales para la captura de insectos plagas, etc. Diferentes tecnologías/metodologías como las anteriormente citadas han sido ajustadas y validadas a partir de procesos de experimentación participativa con el objetivo de estudiar cuales son las condiciones de la zona que mejor se adaptan al tipo de cultivo y de incrementar la productividad de sistemas de cultivos sustentables.
I am a sort of hyperactive organelle. I am full of energy, and I send out energy to all parts of the cell. Breathe, Breathe, What am I?
Mitochondria is a organelle which is full of energy. It sends to all parts of cell in the form of ATP.
What is mitochondria?The majority of the chemical energy required to drive a cell's metabolic operations is produced by mitochondria, which are membrane-bound cell organelles (mitochondrion, singular). Adenosine triphosphate, a tiny molecule, serves as a storage container for the chemical energy generated by the mitochondria (ATP).
Small chromosomes found in mitochondria are found there. In most cases, mitochondria and consequently mitochondrial DNA are exclusively passed down from the mother.
Organelles that are membrane-bound include mitochondria, however they are membrane-bound with two distinct membranes.
Therefore, Mitochondria is a organelle which is full of energy. It sends to all parts of cell in the form of ATP.
To learn more about mitochondria, refer to the link:
https://brainly.com/question/10688306
#SPJ1
1. Why is Carbon important?
this is correct answer oky
Energy requiring metabolic pathways that yield complex molecules from simpler precursors are: A) amphibolic. B) anabolic. C) autotrophic. D) catabolic. E) heterotrophic
Energy requiring metabolic pathways that yield complex molecules from simpler precursors are: anabolic. The correct option is (B).
Anabolic pathways are those metabolic pathways in which simple molecules are combined to form more complex molecules. These pathways require energy, usually in the form of ATP, to drive the chemical reactions that synthesize complex molecules from simpler precursors.
Anabolic pathways play an important role in building the macromolecules needed for cellular structures and functions, such as proteins, nucleic acids, and complex carbohydrates. These pathways are also involved in the storage of energy in the form of glycogen, lipids, and other complex molecules.
Examples of anabolic pathways include protein synthesis, DNA replication, and glycogen synthesis. These pathways are often linked to catabolic pathways, which break down complex molecules into simpler ones and release energy.
Together, anabolic and catabolic pathways maintain the balance of chemical reactions in the cell, allowing it to grow, divide, and carry out its functions.
To know more about "Anabolic" refer here:
https://brainly.com/question/14932822#
#SPJ11
Will the sequences 5′GGCC–3′ and 3′–GGCC–5′ in a double-stranded DNA molecule be cut by the same restriction enzyme?
Adenine and thymine form bonds; guanine and cytosine form bonds. 3'TGACGACTACAACTTAATCT 5' (That is true.)
What do you meant by double-stranded DNA molecule?Two polynucleotide chains, each of which has a nitrogenous base bonded to a hydrogen atom by a hydrogen bond, make up double-stranded DNA. Because of the anti-parallel sugar-phosphate backbone orientation and the complementary nature of the A-T and C-G base pairing, one strand in this arrangement replicates the other. Non-covalent (hydrogen) bonds typically hold the two strands of DNA together in DNA molecules. In a helical pattern, the strands are entangled. Nucleotide sequences are what make up DNA. A deoxyribose sugar, a phosphate group, and one of the four nucleobases (A, T, G, or C) make up each nucleotide. The DNA's double-stranded structure provided evidence of a replicating process. Unnoticed was the fact that it also acted as a template for fixing replication-related damage and errors, helping to maintain genomic stability.To learn more about double-stranded DNA molecule refer to:
https://brainly.com/question/29808616
#SPJ4
The release of water vapor from sweat glands when we are not sweating is a process called.
The release of water vapor from sweat glands when we are not sweating is a process called insensible perspiration
However, the fuid lost in insensible perspiration is pure water.
In order words, it is the loss of water vapor from the sweat gland through the skin which does not occur as normal perceivable sweat.
What is sweat gland?This is one the glands present in the skin of mammals. It produces sweat. The sweat passes through sweat pore
What is insensible perspiration?Insensible perspiration is defined as a process which involves the loss of water vapor from the sweat gland through the skin. No solute is lost in sensible perspiration
Learn more about perspiration:
https://brainly.com/question/10064456
How do I do this worksheet?
Answer:
graph as much as you can on that graph
Explanation:
then explain that you can't graph all of the data bc the x and y values do not go up high enough
hllo baby
good night
Answer:
Okay
Explanation:
Based on the context clue in the
sentence below, what does
brilliant mean?
The ball was a brilliant blue in
stark contrast to the dull, tan
walls of the racquetball courts.
A. dazzling
B. round
C. stuffy
Answer:
i belive is: A. Dazzling
Answer:
dazzling
Explanation:
when they use brilliant in this context, they are seemingly emphasizing the beauty in the pigment of the ball.
The thylakoid membrane contains a protein called atp synthase. As hydrogen ions pass through the protein, adp and a phosphate group are combined to form atp. What is the direct energy source, if any, for the movement of hydrogen ions and the formation of atp? a. The energy source is the high-energy electrons that accompany the hydrogen ions. B. The energy source is the concentration difference of hydrogen ions across the membrane. C. The energy source is a set of atp molecules that gather inside the thylakoid. D. There is no energy source; the process occurs without an energy input.
The energy source is the concentration difference of hydrogen ions across the membrane.
The photochemical and electron transport reactions of oxygenic photosynthesis occur at the thylakoid membrane. The lipid composition of the thylakoid membrane is highly conserved among oxygenic photosynthetic organisms, with two galactolipids, one sulfolipid, and one phospholipid.
The primary functions of thylakoids are to trap light energy and convert it into chemical energy forms such as ATP and NADPH. Water is oxidized and oxygen is released during this process. Inside chloroplasts and cyanobacteria, thylakoids are membrane-bound compartments. They are the site of photosynthesis's light-dependent reactions. Both stages of photosynthesis involve the chloroplast. The light reactions occur in the thylakoid.
To learn more about thylakoid membrane, here
https://brainly.com/question/9122983
#SPJ4
Which of the following terms would best describe the 9th rib from the top on your rib
cage?
True Rib
Floating Rib
False Rib
Articular Rib
Answer:False Rib
Explanation:
What process allows both animal and plant cells to receive the energy
they need in order to carry out their life functions? Explain
Answer:
Metabolism of Carbohydrates
Carbohydrates are one of the major forms of energy for animals and plants. Plants build carbohydrates using light energy from the sun (during the process of photosynthesis), while animals eat plants or other animals to obtain carbohydrates. how do you like the ans rate it
Check all that are a function of the hypothalamus.1)Control of autonomic nervous system2)Control of the endocrine system3)Visceral response to odors4)Control of emotional behavior5) Control of food and water intake6)Regulation of sleep-wake rhythms7)Control of conscious skeletal muscle movements
Hypothalamus controls the autonomic nervous system, the endocrine system, emotional behavior, food, and water intake, and regulates sleep-wake rhythm. Therefore, options A, B, D, E, and F are correct.
What is the hypothalamus?It is the area of the brain that controls temperature, hunger, and thirst. It is located just below the thalamus and under the pituitary gland.
Thus, the hypothalamus controls the autonomic nervous system, the endocrine system, emotional behavior, food, and water intake, and regulates sleep-wake rhythm. Therefore, options A, B, D, E, and F are correct.
Learn more about the hypothalamus, here:
https://brainly.com/question/29699760
#SPJ1
The primary difference between active transport and facilitated diffusion is that active transport is the only one in which
A) [S]high → [S]low.
B) transporter proteins are required.
C) [S]low → [S]high.
D) the concentration gradient provides the necessary energy for movement.
The correct answer is B) transporter proteins are required. Facilitated diffusion and active transport are both mechanisms for moving molecules across a membrane, but they differ in the energy requirements and the use of transporter proteins.
Facilitated diffusion relies on a concentration gradient and uses transporter proteins to move molecules from high to low concentration, but it does not require energy input. In contrast, active transport moves molecules against their concentration gradient, which requires energy input from ATP hydrolysis or other sources, and it always involves transporter proteins to facilitate movement.
Therefore, the key difference between the two processes is the requirement of transporter proteins for active transport.
Learn more about transporter proteins
https://brainly.com/question/5102555
#SPJ4
Ectoprocts and brachiopods are collectively referred to as _____.
A. ecdysozoans
B. eumetazoans
C. flatworms
D. trochophorates
E. lophophorates
Ectoprocts and brachiopods are collectively referred to as lophophorates, option E is correct.
Lophophorates are a group of marine invertebrates characterized by a specialized feeding structure called a lophophore, which consists of ciliated tentacles surrounding the mouth. Ectoprocts (also known as bryozoans) and brachiopods are both members of the lophophorate phylum.
Ectoprocts and brachiopods, as phosphorates, share several characteristics despite being distinct groups. Both ectoprocts and brachiopods are filter feeders, utilizing their lophophores to capture food particles from the water. They also possess a hard outer covering, with ectoprocts forming colonies of tiny individuals encased in protective structures known as zooids, and brachiopods having two pivoted shells that enclose their soft body parts, option E is correct.
To learn more about Ectoprocts follow the link:
https://brainly.com/question/14991506
#SPJ4
In biotechnology procedures, a(n) ____ is a nucleic acid fragment that is used to search for and identify a sequence of interest.
antibody
probe
library
vector
plasmid
Answer:
probe
Explanation:
hope this helps
have an awesome day - TJ
brainliest pls
A student analyzes a cross section of earth's layers. which letter corresponds to a trench in the cross section? question 11 options: l m n o
Answer: its M
Explanation:
i did the k-12 test :)
what part of making the product gave it the most points
Answer:
Price point analysis enables retailers to verify that their prices are both attractive for consumers while also generating maximum possible if this is what you are talking about if not then don't mind this
Explanation:
a dose-response curve shows: group of answer choices the dose of a given chemical that is lethal to 50% of the population. the dose of a given chemical that causes 50% of a population to exhibit a response. the correct dose to use in the treatment of illness. the effect of different doses on a population of test organisms.
Answer: In cases like these usually we follow median effective dose .
The 50% that cause a response are considered highly reactive cases.
This number has common use as what a clinician or patient can expect for a drug effect.
Explanation:
Dose-response data are typically graphed with the dose or dose function (eg, log10 dose) on the x-axis and the measured effect (response) on the y-axis. Drug effects may be quantified at the level of molecule, cell, tissue, organ, organ system, or organism.
Dose-response, which involves the principles of pharmacokinetics and pharmacodynamics, determines the required dose and frequency as well as the therapeutic index for a drug in a population. The dose-response curve is the graphical representation of the relationship between the dose of a drug versus the effects that the drug exerts on the system tested, depicting the magnitude of the response of the organism, either therapeutic or toxic.
The response is measured within a range of concentration and often not measured at different times after the biological system is treated with the drug.
To know more about dose-curve:
https://brainly.in/question/26926519
https://brainly.com/question/24844489