hhmi Biolnteractive Niche Partitioning and DNA Metabarcoding Click & Learn Student Worksheet OVERVIEW This worksheet complements the Niche Partitioning and DNA Metabarcoding Click & Learn. PROCEDURE In the Click & Learn, you will collect and analyze data to test the hypothesis that herbivore species can coexist in the same habitat because they partition their niches in some way. Follow the instructions in the worksheet to guide you through the Click & Learn and answer the questions below as you progress through different sections. INTRODUCTION: STUDYING NICHE PARTITIONING 1. Based on previous knowledge, how would you define biodiversity? 2. Why should people be interested in maintaining biodiversity? Watch Dr. Rob Pringle's video at the beginning of the Click & Learn. Using the arrows to the right of the screen, continue through the background information about Mpala Research Center. 3. How does niche partitioning relate to biodiversity?

Answers

Answer 1

Including human existence, depend on biodiversity. Without a wide range of organisms, including animals, plants, and microorganisms, our ecosystems cannot be healthy.

Why is biodiversity important? What is it?

In the context of our world, the term "biodiversity" refers to the variety of all the different species of living things, including all the different types of plants, animals, insects, and microorganisms. Each of these organisms coexists with others in ecosystems in order to sustain and support life on earth.

What are the two advantages of preserving biodiversity?

Maintaining genetic diversity supports the survival of a variety of crops that may be disease-resistant and possibly beneficial biochemicals, such as those used in medicine. It also refers to the species' accessibility.

To know more about biodiversity visit:-

https://brainly.com/question/13073382

#SPJ1


Related Questions

what is the backbone of RNA made out of?​

Answers

Answer:

Explanation:

It has a deoxyribose and phosphate backbone having four distinct bases: thymine, adenine, cytosine, and guanine. Is a polymer with a ribose and phosphate backbone with four varying bases: uracil, cytosine, adenine, and guanine.

Which type of mutation affects the largest number of genes? A. Missense mutation B. Silent mutation C. Point mutation D. Chromosomal mutation




Answer is: Chromosomal mutation

Answers





Chromosomal mutation

Is 7 a domain or range?

Answers

The domain of y=7 is \(\mathbb{R}\). And, the range is [7,7]. So 7 is both range and domain.

The domain of a function is the variety of values that can be inserted into it. A function's range is the collection of possible values that it can take on its own.  A logarithmic function's domain is all real numbers greater than zero, and its range is all real values.

Given that y=7. Here, the number 7 is a real number and this number is greater than zero. Therefore, all the real number is considered as the domain i.e., \(\mathbb{R}\) is domain and the range is {7}=[7,7].

To know more about the domain:

https://brainly.com/question/9832306

#SPJ4

What is the function of the enzyme topoisomerase in DNA replication? (A) relieving strain in the DNA ahead of the replication fork caused by the untwisting of the double helix (B) elongating new DNA at a replication fork by adding nucleotides to the existing chain (C) reattaching the hydrogen bonds between the base pairs in the double helix (D) building RNA primers using the parental DNA strand as a template

Answers

The function of the enzyme topoisomerase in DNA replication is relieving strain in the DNA ahead of the replication fork caused by the untwisting of the double helix.

Nuclear enzymes known as topoisomerases are crucial for DNA replication, transcription, chromosome segregation, and recombination. These enzymes come in two main varieties; type I enzymes pass one or two DNA strands through the break before sealing it, whereas type II molecules cleave both DNA strands simultaneously and religate the double-strand break after passing another double strand through the break.  By splitting, swiveling, and reconnecting DNA strands, a topoisomerase corrects "overwinding" before replication forks. This enzyme, to put it simply, stops the DNA double helix before the replication fork from becoming too wrapped as the DNA is opened up. Therefore, this enzyme stops DNA from supercoiling.

To learn more about topoisomerase and replication fork here,

https://brainly.com/question/16249394

#SPJ4

Organelles called plastids are found in

Answers

Answer:

fHay dos tipos de plastos claramented diferenciados, según la estructura de sus membranas: los plastos primarios, que se encuentran en la mayoría de las plantas y algas; y plastos secundarios, más complejos, que se encuentran en el plancton

Explanation:

Over a long period of time, the
average temperature and
precipitation
of an area is called
A. regional pressure
B. climate
C. temperate

Answers

Answer:

B climate

Explanation:

Climate means over a long period of time like years, months, decades, and centuries, but tempurature is only for a few hours, minutes or days.

Answer: Justice.

Explanation: The Answers Justice.

you recently discovered a new photosynthetic bacterial cell. based on your knowledge of prokaryotes, what else should be present in the cell?

Answers

newly discovered photosynthetic bacterial cell, and considering the knowledge of prokaryotes, the following components should also be present in the cell:

1. Cell wall: A rigid structure surrounding the cell membrane, providing protection and support.
2. Plasma membrane: A semi-permeable barrier that controls the movement of substances in and out of the cell.
3. Cytoplasm: The jelly-like substance inside the cell where various metabolic reactions occur.
4. Ribosomes: The structures responsible for protein synthesis.
5. Nucleoid region: The region containing the bacterial cell's genetic material, such as circular DNA.

In summary, a newly discovered photosynthetic bacterial cell should have a cell wall, plasma membrane, cytoplasm, ribosomes, and a nucleoid region, based on our knowledge of prokaryotes.

To know more about cell visit :-

https://brainly.com/question/13920046

#SPJ11

Pathogens, like disease causing viruses, can enter the body through the blood stream. Phagocytic white blood cells will respond by releasing enzymes and by ingesting the pathogens to destroy them. What transport process is used by these white blood cells to ingest the virus?

A) facilitated diffusion

B) sodium-potassium pump

C) exocytosis

D) endocytosis

Answers

Answer:

did u ever find out what the answer was??

Explanation:

1. Riparian vegetation limits meandering, causing downcutting and a reduced water table.
True / False
2. A guild is a fish feeding classification based on where they reproduce in water column
True / False
3. A primary producer is defined as a living organism such as algae that can convert nutrients, carbon dioxide, water and energy from the sun into living matter.
True / False
4. In riparian areas, soil acts like a sponge to retain water .
True / False
5. Feeding relationships of organisms determine the pathways of energy flow through the aquatic system
True / False
6. The total area drained by a stream or river is called a:
a) landscape
b) catchment
c) riparian zone
d) hydrologic cycle
7. Benthic refers to the assemblage of organisms inhabiting the bottoms of streams, lakes, and ocean.
True / False

Answers

The statement is true. Riparian vegetation limits meandering, causing downcutting and a reduced water table. In areas where vegetation has been removed, the riverbank may be eroded due to increased water flow. The given statement is false. A guild is a fish feeding classification based on the type of food they eat.

The given statement is true. A primary producer is defined as a living organism such as algae that can convert nutrients, carbon dioxide, water and energy from the sun into living matter. The given statement is true. In riparian areas, soil acts like a sponge to retain water. Riparian vegetation can help to increase soil permeability, which in turn helps to reduce the speed of water flow and prevent soil erosion. The given statement is true. Feeding relationships of organisms determine the pathways of energy flow through the aquatic system.

Organisms in the lower trophic levels are eaten by those in the higher trophic levels. This process continues until the top predator in the food chain is reached. The total area drained by a stream or river is called a catchment. The catchment includes all the water that flows into the stream or river, including surface runoff, subsurface flow, and groundwater. The given statement is true. Benthic refers to the assemblage of organisms inhabiting the bottoms of streams, lakes, and ocean.

To know more about vegetation visit:

https://brainly.com/question/28405832

#SPJ11

what tool is used to determine the precise location of radioactively labeled DNA

Answers

The answer: The Geiger Counter

What is the difference between DNA content and chromosomes number, thanks

Answers

Answer:

I have been to get a

Explanation:

I c have a true conclusion for my head but I think it is a good way for me to get

¿de que manera el desarrollo cientifico y tecnologico repercute en la agricultura ecologica ,como parte de las condiciones para la propuesta de emprendimiento familiar?

Answers

Answer:

Los desarrollos científico-tecnológicos han impactado positivamente sobre los sistemas de agricultura ecológica y en última instancia también sobre la agricultura familiar

Explanation:

La agricultura ecológica refiere a los procedimientos de explotación agrícola basados en la utilización sustentable de los recursos de la tierra y los métodos de fertilización orgánica, respetando el ambiente natural y evitando el uso de compuestos químicos artificiales (como por ejemplo plaguicidas químicos) y de cultivos transgénicos. Por otra parte, la agricultura familiar refiere a un tipo de agricultura ecológica basado en la dirección y la administración familiar. La agricultura familiar es el sistema de agricultura predominante en regiones pobres de América Latina y el Caribe, representando aproximadamente el 80 % de la producción agrícola. De este modo, el desarrollo de métodos eficientes de agricultura/ecológica familiar resultan fundamentales para lograr la seguridad alimentaria en la región y también para mitigar los efectos negativos del cambio climático. En este contexto, diferentes avances científico-tecnológicos han impactado positivamente sobre el manejo, eficiencia y productividad de la agricultura familiar como sistema de cultivo no sólo sustentable sino también eficiente, entre los cuales se destacan el desarrollo de mini-invernaderos, variedades mejoradas obtenidas a través de técnicas de mejoramiento genético convencional (selección a campo), trampas artesanales para la captura de insectos plagas, etc. Diferentes tecnologías/metodologías como las anteriormente citadas han sido ajustadas y validadas a partir de procesos de experimentación participativa con el objetivo de estudiar cuales son las condiciones de la zona que mejor se adaptan al tipo de cultivo y de incrementar la productividad de sistemas de cultivos sustentables.

I am a sort of hyperactive organelle. I am full of energy, and I send out energy to all parts of the cell. Breathe, Breathe, What am I?

Answers

Mitochondria is a organelle which is full of energy. It sends to all parts of cell in the form of ATP.

What is mitochondria?

The majority of the chemical energy required to drive a cell's metabolic operations is produced by mitochondria, which are membrane-bound cell organelles (mitochondrion, singular). Adenosine triphosphate, a tiny molecule, serves as a storage container for the chemical energy generated by the mitochondria (ATP).

Small chromosomes found in mitochondria are found there. In most cases, mitochondria and consequently mitochondrial DNA are exclusively passed down from the mother.

Organelles that are membrane-bound include mitochondria, however they are membrane-bound with two distinct membranes.

Therefore, Mitochondria is a organelle which is full of energy. It sends to all parts of cell in the form of ATP.

To learn more about mitochondria, refer to the link:

https://brainly.com/question/10688306

#SPJ1


1. Why is Carbon important?

Answers

this is correct answer oky

1. Why is Carbon important?

Energy requiring metabolic pathways that yield complex molecules from simpler precursors are: A) amphibolic. B) anabolic. C) autotrophic. D) catabolic. E) heterotrophic

Answers

Energy requiring metabolic pathways that yield complex molecules from simpler precursors are: anabolic. The correct option is (B).

Anabolic pathways are those metabolic pathways in which simple molecules are combined to form more complex molecules. These pathways require energy, usually in the form of ATP, to drive the chemical reactions that synthesize complex molecules from simpler precursors.

Anabolic pathways play an important role in building the macromolecules needed for cellular structures and functions, such as proteins, nucleic acids, and complex carbohydrates. These pathways are also involved in the storage of energy in the form of glycogen, lipids, and other complex molecules.

Examples of anabolic pathways include protein synthesis, DNA replication, and glycogen synthesis. These pathways are often linked to catabolic pathways, which break down complex molecules into simpler ones and release energy.

Together, anabolic and catabolic pathways maintain the balance of chemical reactions in the cell, allowing it to grow, divide, and carry out its functions.

To know more about "Anabolic" refer here:

https://brainly.com/question/14932822#

#SPJ11

Will the sequences 5′GGCC–3′ and 3′–GGCC–5′ in a double-stranded DNA molecule be cut by the same restriction enzyme?

Answers

Adenine and thymine form bonds; guanine and cytosine form bonds. 3'TGACGACTACAACTTAATCT 5' (That is true.)

What do you meant by double-stranded DNA molecule?Two polynucleotide chains, each of which has a nitrogenous base bonded to a hydrogen atom by a hydrogen bond, make up double-stranded DNA. Because of the anti-parallel sugar-phosphate backbone orientation and the complementary nature of the A-T and C-G base pairing, one strand in this arrangement replicates the other. Non-covalent (hydrogen) bonds typically hold the two strands of DNA together in DNA molecules. In a helical pattern, the strands are entangled. Nucleotide sequences are what make up DNA. A deoxyribose sugar, a phosphate group, and one of the four nucleobases (A, T, G, or C) make up each nucleotide. The DNA's double-stranded structure provided evidence of a replicating process. Unnoticed was the fact that it also acted as a template for fixing replication-related damage and errors, helping to maintain genomic stability.

To learn more about double-stranded DNA molecule refer to:

https://brainly.com/question/29808616

#SPJ4

The release of water vapor from sweat glands when we are not sweating is a process called.

Answers

The release of water vapor from sweat glands when we are not sweating is a process called insensible perspiration

However, the fuid lost in insensible perspiration is pure water.

In order words, it is the loss of water vapor from the sweat gland through the skin which does not occur as normal perceivable sweat.

What is sweat gland?

This is one the glands present in the skin of mammals. It produces sweat. The sweat passes through sweat pore

What is insensible perspiration?

Insensible perspiration is defined as a process which involves the loss of water vapor from the sweat gland through the skin. No solute is lost in sensible perspiration

Learn more about perspiration:

https://brainly.com/question/10064456

How do I do this worksheet?

How do I do this worksheet?

Answers

Answer:

graph as much as you can on that graph

Explanation:

then explain that you can't graph all of the data bc the x and y values do not go up high enough

hllo baby


good night ​

Answers

Answer:

Okay

Explanation:

Based on the context clue in the
sentence below, what does
brilliant mean?
The ball was a brilliant blue in
stark contrast to the dull, tan
walls of the racquetball courts.
A. dazzling
B. round
C. stuffy

Answers

Answer:

i belive is: A. Dazzling

Answer:

dazzling

Explanation:

when they use brilliant in this context, they are seemingly emphasizing the beauty in the pigment of the ball.

The thylakoid membrane contains a protein called atp synthase. As hydrogen ions pass through the protein, adp and a phosphate group are combined to form atp. What is the direct energy source, if any, for the movement of hydrogen ions and the formation of atp? a. The energy source is the high-energy electrons that accompany the hydrogen ions. B. The energy source is the concentration difference of hydrogen ions across the membrane. C. The energy source is a set of atp molecules that gather inside the thylakoid. D. There is no energy source; the process occurs without an energy input.

Answers

The energy source is the concentration difference of hydrogen ions across the membrane.

The photochemical and electron transport reactions of oxygenic photosynthesis occur at the thylakoid membrane. The lipid composition of the thylakoid membrane is highly conserved among oxygenic photosynthetic organisms, with two galactolipids, one sulfolipid, and one phospholipid.

The primary functions of thylakoids are to trap light energy and convert it into chemical energy forms such as ATP and NADPH. Water is oxidized and oxygen is released during this process. Inside chloroplasts and cyanobacteria, thylakoids are membrane-bound compartments. They are the site of photosynthesis's light-dependent reactions. Both stages of photosynthesis involve the chloroplast. The light reactions occur in the thylakoid.

To learn more about thylakoid membrane, here

https://brainly.com/question/9122983

#SPJ4

Which of the following terms would best describe the 9th rib from the top on your rib
cage?
True Rib
Floating Rib
False Rib
Articular Rib

Answers

Answer:False Rib

Explanation:

What process allows both animal and plant cells to receive the energy
they need in order to carry out their life functions? Explain

Answers

Answer:

Metabolism of Carbohydrates

Carbohydrates are one of the major forms of energy for animals and plants. Plants build carbohydrates using light energy from the sun (during the process of photosynthesis), while animals eat plants or other animals to obtain carbohydrates. how do you like the ans rate it

Check all that are a function of the hypothalamus.1)Control of autonomic nervous system2)Control of the endocrine system3)Visceral response to odors4)Control of emotional behavior5) Control of food and water intake6)Regulation of sleep-wake rhythms7)Control of conscious skeletal muscle movements

Answers

Hypothalamus controls the autonomic nervous system, the endocrine system, emotional behavior, food, and water intake, and regulates sleep-wake rhythm. Therefore, options A, B, D, E, and F are correct.

What is the hypothalamus?

It is the area of the brain that controls temperature, hunger, and thirst. It is located just below the thalamus and under the pituitary gland.

Thus, the hypothalamus controls the autonomic nervous system, the endocrine system, emotional behavior, food, and water intake, and regulates sleep-wake rhythm. Therefore, options A, B, D, E, and F are correct.

Learn more about the hypothalamus, here:

https://brainly.com/question/29699760

#SPJ1

The primary difference between active transport and facilitated diffusion is that active transport is the only one in which
A) [S]high → [S]low.
B) transporter proteins are required.
C) [S]low → [S]high.
D) the concentration gradient provides the necessary energy for movement.

Answers

The correct answer is B) transporter proteins are required. Facilitated diffusion and active transport are both mechanisms for moving molecules across a membrane, but they differ in the energy requirements and the use of transporter proteins.

Facilitated diffusion relies on a concentration gradient and uses transporter proteins to move molecules from high to low concentration, but it does not require energy input. In contrast, active transport moves molecules against their concentration gradient, which requires energy input from ATP hydrolysis or other sources, and it always involves transporter proteins to facilitate movement.

Therefore, the key difference between the two processes is the requirement of transporter proteins for active transport.

Learn more about transporter proteins

https://brainly.com/question/5102555

#SPJ4

Ectoprocts and brachiopods are collectively referred to as _____.
A. ecdysozoans
B. eumetazoans
C. flatworms
D. trochophorates
E. lophophorates

Answers

Ectoprocts and brachiopods are collectively referred to as lophophorates, option E is correct.

Lophophorates are a group of marine invertebrates characterized by a specialized feeding structure called a lophophore, which consists of ciliated tentacles surrounding the mouth. Ectoprocts (also known as bryozoans) and brachiopods are both members of the lophophorate phylum.

Ectoprocts and brachiopods, as phosphorates, share several characteristics despite being distinct groups. Both ectoprocts and brachiopods are filter feeders, utilizing their lophophores to capture food particles from the water. They also possess a hard outer covering, with ectoprocts forming colonies of tiny individuals encased in protective structures known as zooids, and brachiopods having two pivoted shells that enclose their soft body parts, option E is correct.

To learn more about Ectoprocts follow the link:

https://brainly.com/question/14991506

#SPJ4

In biotechnology procedures, a(n) ____ is a nucleic acid fragment that is used to search for and identify a sequence of interest.

antibody

probe

library

vector

plasmid

Answers

Answer:

probe

Explanation:

hope this helps

have an awesome day - TJ

brainliest pls

A student analyzes a cross section of earth's layers. which letter corresponds to a trench in the cross section? question 11 options: l m n o

Answers

Answer: its M

Explanation:

i did the k-12 test :)

what part of making the product gave it the most points

Answers

Answer:

Price point analysis enables retailers to verify that their prices are both attractive for consumers while also generating maximum possible if this is what you are talking about if not then don't mind this

Explanation:

a dose-response curve shows: group of answer choices the dose of a given chemical that is lethal to 50% of the population. the dose of a given chemical that causes 50% of a population to exhibit a response. the correct dose to use in the treatment of illness. the effect of different doses on a population of test organisms.

Answers

Answer: In cases like these usually we follow median effective dose .

The 50% that cause a response are considered highly reactive cases.

This number has common use as what a clinician or patient can expect for a drug effect.

Explanation:

Dose-response data are typically graphed with the dose or dose function (eg, log10 dose) on the x-axis and the measured effect (response) on the y-axis. Drug effects may be quantified at the level of molecule, cell, tissue, organ, organ system, or organism.

Dose-response, which involves the principles of pharmacokinetics and pharmacodynamics, determines the required dose and frequency as well as the therapeutic index for a drug in a population. The dose-response curve is the graphical representation of the relationship between the dose of a drug versus the effects that the drug exerts on the system tested, depicting the magnitude of the response of the organism, either therapeutic or toxic.

The response is measured within a range of concentration and often not measured at different times after the biological system is treated with the drug.

To know more about dose-curve:

https://brainly.in/question/26926519

https://brainly.com/question/24844489

Other Questions
How did missionaries help spread Christianity throughout Europe? a statistical relationship between two variables is considered statistically significant if it is stronger than what percent of relationships we'd expect to see by chance. Help Ill give you brainly A bus is traveling at a constant speed and goes 8. 4 miles in 5 minutes. Using your strategy, how far does the bus travel in one minute? In a direct variation, y=16 when x=2. Write a direct variation equation that shows the relationship between x and y. How can you tell a chemical change has happened? according to the individuals with disabilities education improvement act-2004 (idea-2004), an individual can have a learning disability in which of the following areas? Why did Europeans colonize new lands ? If cos(t) =2/9 and t is in the 1st quadrant, find sin(t) Simplify. Assume that all variables are nonnegative real numbers.(32a^10b^11)(32a^10b^11) = ...(Type an exact answer, using radicals as needed.) a 38.0-turn solenoid of length 5.70 cm produces a magnetic field of magnitude 2.20 mt at its center. find the current in the solenoid. nurse denise is preparin to assess kellen's gross motor develoopment. which ofthe folloing gross motor skills should kellen accomplish 1. Find the probability of randomly selecting cards that is less than a 10 of spades? 6:51,6:30, 6:07,5:42,5:15,?What is the next time, pattern Assume you will purchase a new car. The dealer is currently offering a special promotion: you can choose A) a $1500 rebate up front with 6% financing OR B) 0% financing for the first 36 months and 6% financing for the last 2 years. Both loans are 5 years. Find the car you want to purchase and its cost and where you can purchase it from.(Do this from online or at a dealership) What were the affects on russia in WW1? The XYZ Company is planning a new product line and a new factory to produce the parts and assemble the final products. The product line will include 13 different models. Annual production of each model is expected to be 1,000 units. Each product will be assembled of 250 components, but 65% of these will be purchased parts (not made in the new factory). There is an average of 8 processing operations required to produce each component, and each processing step takes 30 sec (including an allowance for setup time and part handling). Each final unit of product takes 48 min to assemble. All processing operations are performed at work cells that include a production machine and a human worker. Products are assembled at single workstations consisting of one worker each plus assembly fixtures and tooling. Each work cell and each workstation require 25 m2 of floor space and an additional allowance of 45% must be added to the total production area for aisles, work-in-process storage, shipping and receiving, rest rooms, and other utility space. The factory will operate one shift (the day shift, 2,000 hr/yr). Determine: (a) how many processing and assembly operations, (b) how many workers (direct labor only), and (c) how much total floor space will be required in the plant. Physical activity must be strenuous to be effective. Which statement below accurately describes Hope's gross wages? a. Gross wages are calculated by multiplying Hope's hourly rate by the number of hours she workedb. Gross wages are Hope's fixed salary, which she receives for every pay periodC. Gross wages are calculated by subtracting all of Hope's deductions from her gross incomed. Gross wages are how much Hope has earned over the course of the entire year Which is an example of a noncontract force?(A) elastic force(B) Normal force(C)Applied force(D) Electric Force