Compare and contrast the reason behind the failure of Polaroid
with the insight from the failure of Kodak.

Answers

Answer 1

Both Polaroid and Kodak were iconic companies in the photography industry that faced significant challenges and ultimately failed. While both companies struggled to adapt to the digital age, their reasons for failure differed. Polaroid's downfall can be attributed to its inability to transition from instant film to digital photography, as well as its failure to capitalize on emerging technologies. On the other hand, Kodak's failure stemmed from its slow response to the digital revolution, despite having early knowledge and technology in digital imaging. Kodak's focus on film and its reluctance to embrace digital innovation ultimately led to its demise.

Polaroid's failure can be traced back to its failure to adapt to the digital revolution. The company was known for its instant film cameras, but as digital photography gained popularity, Polaroid struggled to keep up. It failed to invest adequately in digital imaging technology and missed out on opportunities to enter the digital camera market. Additionally, Polaroid faced financial challenges and went through bankruptcy, further hindering its ability to compete.

Kodak's failure, on the other hand, was partly due to its overreliance on its film business. Despite having early knowledge and technology in digital imaging, Kodak was slow to embrace the digital transition. The company held onto its film-based business model for too long, failing to recognize the rapid growth and potential of digital photography. By the time Kodak decided to shift its focus to digital, competitors had already gained a significant market share, and Kodak struggled to catch up.

In summary, while both Polaroid and Kodak faced challenges in adapting to the digital era, Polaroid's failure was primarily due to its inability to transition to digital, while Kodak's failure was rooted in its delayed response and reluctance to embrace digital innovation.

learn more about photography here:

https://brainly.com/question/26577274

#SPJ11


Related Questions

fill it out please ok guys

fill it out please ok guys

Answers

Cant see the article

Which of the following is NOT intellectual property?
A.
a new office building
B.
the design for the building
C.
a painting of the building
D.
software used inside the building

Answers

I believe its C

Intellectual Property is a category of property that includes intangible creation of the human intellect.

Since painting is tangible, it's not an Intellectual property.

Answer:

I think it is B, if not dont get mad, my bad.

Explanation:

choose an example of a divine intervention of some kind in the first half of the iliad (and there are many, many examples). what does this intervention tell you about the gods/fate/destiny, and what does it tell you about human agency?

Answers

One example of divine intervention in the first half of the Iliad is when the god Apollo intervenes to help the Trojans against the Greeks.

Apollo is  infuriated by the Greeks ’ treatment of his son, the Trojan  Napoleon, and sends a pest to their camp. This  godly intervention reveals the gods ’ power over the human characters and their capability to  impact events. It also speaks to the idea of fate, as the gods can change the  outgrowth of events. Despite this,  human agency still matters as the

Human can choose to defy the gods, as the Greek idol Achilles does when he decides to fight despite Apollo’s pest.

To know more about divine intervention  visit:

https://brainly.com/question/12964712

#SPJ4

WILL GIVE BRAINLIEST
Which way does the equator run through Africa?

through the northern section
through the southern tip
through the center

Answers

Answer:

through the center

Explanation:

In Africa, the equator runs for almost 2,500 miles/ 4,020 kilometers through seven West, Central and East African countries just south of the Sahara Desert

Answer:

center

Explanation:

answer the question I will give BRAINLIEST ​

answer the question I will give BRAINLIEST

Answers

hi, I don’t know if you already got the answer but quizlet said it’s D!

Explain the Canadian attitudes towards the varied expression of sexuality. (Maximum 1 page)

Identify the basic information required for American Psychological Association (APA) citation in the writing papers. (Maximum 1 page)

Answers

Committed to improving gender, sexual orientation, gender identity, and gender expression equality via the involvement of persons of all genders, especially women, in Canada's economic, social, and political life. Always include the author's surname and the date of publication.

A comma should be placed between the author's name and the year of publication: (Fisher, 2012). Only the publication date needs to be included in brackets if the author's name is given in the sentence where the citation appears. This means that the author's last name and the year of publication for the source, for example, (Jones, 1998), should be in the text, and a complete citation should appear in the reference list at the end.

To learn more about equality, click here.

https://brainly.com/question/9070018

#SPJ4

Being a member of a gang is necessary if you want to feel safe. Please select the best answer from the choices provided. T F.

Answers

Answer:

F

Explanation:

this is coming from government classes obviously they will say jo and say they will protect you.

what is the best way to solve conflict​

Answers

Act almost uninterested in a way and have calm precision with what you say. Keep a neutral face throughout conversation. Good idea to record conversation for backup. Make sure not to look down on or pity the other person and talk to them like a proper human being. Make sure to stay calm and neutral when in conflict so nobody feels as if your choosing sides. Also make sure that you prepared to admit to what you did wrong.

Explain the Civil Rights movement. What happened during this time? What caused it to happen? Cite 1 significant event that led to the end of segregation.

Answers

Answer:

I was caused by segregation between African Americans and Whites.

Explanation:

The civil rights movement is a period in america's history from around the early 50s to mid 60s. Everything had 2 areas. One for African American's and Whites. It was caused because Whites still believed they were the supreme race and that African American's were a lesser one. 1 significant event that led to the end of segregation was Dr Martin Luther King Jr's I have a dream speech.

The mectizan donation program is most accurately characterized by which approach to corporate social engagement?

Answers

The Mectizan Donation Program can be characterized as an example of Corporate Social Responsibility (CSR). CSR is a business approach that involves companies taking responsibility for their impact on society and the environment, beyond just creating profit for shareholders.

The Mectizan Donation Program is a CSR initiative led by Merck & Co., Inc., which donates the drug Mectizan (ivermectin) to treat river blindness (onchocerciasis) in developing countries where the disease is endemic.

The program has been in operation since 1987 and has treated millions of people around the world, demonstrating Merck's commitment to addressing important social and health issues.

CSR initiatives like the Mectizan Donation Program can help companies build stronger relationships with stakeholders and enhance their reputation, while also contributing to social and environmental goals.

To know more about Corporate Social Responsibility:

https://brainly.com/question/13528806

#SPJ4

Kyle believes that his school is better than all of the other schools in his school district. Kyle's belief BEST illustrates: conformity. the fundamental attribution error. stereotyping. in-group bias.

Answers

Kyle's belief that his school is better than all the other schools in his district BEST illustrates in-group bias. In-group bias refers to the tendency to favor one's own group over other groups. In this case, Kyle identifies with his school and considers it as part of his in-group.

He believes that his school is superior to the other schools, which suggests that he has a positive bias toward his own school. This bias is common in group situations where people identify with a particular group and view it positively. Therefore, Kyle's belief about his school is an example of in-group bias.


Kyle's belief that his school is better than all other schools in his district BEST illustrates in-group bias. In-group bias refers to the tendency for people to favor their own group and view it more positively compared to other groups. In this case, Kyle's school represents his in-group, and he demonstrates this bias by believing that his school is superior to others in the district.

This does not represent conformity, fundamental attribution error, or stereotyping, as these terms refer to different psychological concepts not directly related to favoring one's own group.

To know more about positive bias, visit:

https://brainly.com/question/31211987

#SPJ11

The type of conflict is exemplified by deciding which homework to start first, from the two subjects that you don’t like would be

Answers

Avoidance-avoidance is the type of conflict is exemplified by deciding which homework to start first, from the two subjects that you don’t like.

What is Avoidance-avoidance conflict?When faced with a difficult choice, a person may feel that ignoring the choice altogether is a convenient, temporary fix. In psychology, avoidance refers to the deliberate efforts made by a person to steer clear of particular decisions, pursuits, or circumstances in order to avoid unpleasant emotions or outcomes.Avoidance is a coping strategy used by people to shield themselves from discomfort and anxious feelings. Although many people would like to avoid making unpleasant choices, procrastinating frequently makes matters worse by delaying the inevitable.Nevertheless, there are benefits to utilizing avoidance as a strategy in some confrontations. When faced with a difficult decision between two unpalatable options, giving each option more thought can aid the decision-maker in reaching a more well-informed conclusion.

To know more about Avoidance-avoidance with the given link

https://brainly.com/question/3816913

#SPJ4

Answer:
Avoidance-avoidance

Explanation:
Cause since you don't want to do NEITHER of the two but u have to. nothing of it is making yourself positive so is a lose lose instead of a win win.

24. Suppose a nation is ruled by a single person who holds absolute power over the national government and the lives of citizens. Which type of government does this nation have?

an oligarchy

a dictatorship

a monarchy

a democracy

Answers

This sort of governance is known as a dictatorship. Hence, the correct answer is a dictatorship.

What is the definition of a dictatorship government?

A dictatorship is distinguished by a single leader who has complete control over the party and the country. Propaganda, as well as real support, will frequently portray them as the people's heroes. Individual citizens' rights are entirely ignored by a dictatorship. The government and state will use laws, police, espionage, and coercion to control all citizens. A dictatorship's most valuable asset is its government and state. There is only one party in a dictatorship, and all opposition is suppressed or prohibited. Under totalitarian states, dissent and elections are prohibited. In a dictatorship, the government controls every aspect of people's life, including radio, movies, and newspapers.

To learn more about dictatorship, click

https://brainly.com/question/29831407

#SPJ1

i kissed someone with a cold sore what should i do

Answers

Visit a healthcare provider: If you have never had a cold sore before, you should visit a healthcare provider to confirm the diagnosis and get proper treatment.

I am a language model AI and cannot give medical advice, however here are some general guidelines: For an accurate diagnosis and treatment, seek the advice of a physician or other healthcare provider. Don't kiss, share towels, cutlery, or personal care items with others. Wash your hands often and maintain proper hygiene. Reduce the severity and length of the cold sore with antiviral medicine as directed by your doctor. As soon as the cold sore has healed completely, avoid physical contact with other people. Dry off and keep the afflicted area clean. Apply a lip balm or ointment to the afflicted region to protect it from additional irritation and to treat the symptoms.

Learn more about kiss here:

https://brainly.com/question/25947104

#SPJ4

Why does Grimes say he does not talk about his wife too frequently in the narrative.

Answers

Throughout his story, Grimes remains truthful and dry about the torture he receives from his masters and mistresses; rather than expressly preaching against the violence of slavery, his honest accounts of the abuse he endures serve as a scathing condemnation of the practice.

Grimes is sold to Col. William Thornton when he is ten years old, and the two then transport him to the Montpelier farm in Culpepper, Virginia, where the other slaves are jealous of him since he is a house slave.

In an effort to have one of their relatives take his position in the home, they disrupt his employment. The family's coffee is made by Grimes, but the mistress's head servant adds cough syrup and accuses Grimes of attempting to poison the family.

Learn more about slavery here:

https://brainly.com/question/866336

#SPJ1

A red four o'clock flower (RR) is crossed with a white four o'clock flower (WW) and the resulting F1 offspring are all pink (RW). If two of the pink offspring are crossed, what proportion of genotypes would you expect to see in the F2 generation?

Answers

If two of the pink offspring are crossed then the proportion of genotypes would be expect to see in the F2 generation is the cross which can be represented as genotypes in F2 generation are: RR : 1 - RW : 2 - WW : 1. So, the correct answer is '1RR: 2RW: 1WW'. Option C is correct.

What is Genotypes?

The term "genotypes" refers to an organism's whole gene pool, or, in other words, the genetic make-up of that creature. The phrase can also be used to describe to the alleles, or different forms of a gene, that an organism carries in a more specific meaning.

The type of variant present at a specific locus (i.e., region) in the genome is scored by what is known as a genotype. Symbols can be used to symbolize it. For illustration, BB, Bb, and bb could be used to denote a certain gene variant.

Thus the genotype made in two pink flowers are crossed is '1RR: 2RW: 1WW.

Learn more about Genotypes refer:

https://brainly.com/question/12116830

#SPJ1

Which of these causes of migration is an example of a pull factor?
A.
warfare
B.
poverty
C.
job availability
D.
an earthquake

Answers

Answer:

job availability

Explanation:

Job availability of these causes of migration is an example of a pull factor. Thus, option (c) is correct.

What is migration?

The term migration refers to a person to change the location, country, place of residence are the change. The migration are to settle to the another place.  Migration is the change of the residence to shift the permanent place. International migration are to switch of the country.

Job availability refers to the flexibility in the work such as a full-time job, a shift job or a part-time position. Job availability are the only good things are available in the job. The migration to move to another place for the purpose of the job. A people grab the opportunity, for they shift to another place.

As a result, the poverty related to the poor, earthquake related to the nature, warfare is related to the war. But, only job availability only related to the migration. Therefore, option (c) is correct.

Learn more about migration, here:

https://brainly.com/question/17991559

#SPJ2

CCAN SOMEONE HELP ME WITH THIS PLS

CCAN SOMEONE HELP ME WITH THIS PLS

Answers

Answer:

c

Explanation:

Words, names, symbols, or devices used to identify a product or service are protected by __________.
A.
patents
B.
insignias
C.
trademarks
D.
copyrights

Answers

Answer:

C. Trademarks

Explanation:

Answer:

c

Explanation:

why is there likely a class bias in the interest group system in texas?

Answers

There is likely a class bias in the interest group system in Texas because wealthier individuals and corporations have more resources and influence to actively participate in the political process and shape policy outcomes.

The interest group system in Texas, like in many other places, tends to favor those with more financial resources and influence. Wealthier individuals and corporations have the means to hire lobbyists, fund political campaigns, and engage in direct advocacy efforts. They can also afford to join and support influential interest groups that align with their interests. As a result, their voices and priorities are more likely to be heard and considered by policymakers.

On the other hand, individuals from lower-income backgrounds may face barriers to participating in the interest group system due to limited resources and access to political networks. This class bias can lead to the unequal representation of interests and potentially marginalize the concerns of disadvantaged groups.

You can learn more about interest group system at

https://brainly.com/question/30132099

#SPJ11

Interest groups have proliferated in Texas because wealthy individuals have greater influence over politicians due to their financial contributions, access to media, and political connections.

The interest group system in Texas is biased toward the wealthier class. The most prominent interest groups in Texas are the ones representing businesses, including the oil and gas industry. These interest groups have a lot of money and resources that they use to influence Texas politics. As a result, politicians tend to prioritize their interests over those of the general public. This makes it harder for other interest groups representing the middle and lower classes to have their voices heard. The unequal distribution of wealth in Texas is one of the main reasons for the class bias in the interest group system. Wealthy individuals and businesses can contribute more money to political campaigns, which gives them greater access and influence over politicians. This makes it more difficult for groups representing the middle and lower classes to have an equal voice in the political process.

To know more about politics, visit:

https://brainly.com/question/12443795

#SPJ11

. In Da Vinci's Last Supper, this new art technique is present in the painting which allowed to represent a
three-dimensional world onto a two-dimensional surface​

Answers

Answer:

Da vinci used the technique called Vanishing Point.

Explanation:

In "The last Supper" Da Vince used in the right eye of Christ, a technique called "Vanishing Point", this technique allowed for depth, creating a three-dimensional image.

This technique consists in selecting a single point on the horizontal line of the painting, which in this case was Christ's right eye, where all the parallel lines will meet and project forward, in different directions.

If total spending is greater than the value of output, firms will
cut prices.
decrease production levels.
tend to raise prices.
see inventories rise.

Answers

If total spending is greater than the value of output, firms will tend to raise prices.

When total spending surpasses the value of output, it suggests that there is excess demand in the economy. In such a scenario, firms have the opportunity to increase their prices because there is a high level of consumer demand for their products or services. By raising prices, firms can capture more revenue and potentially increase their profits. When demand outpaces supply, firms can take advantage of the favorable market conditions and adjust their pricing strategy to maximize their earnings.

Raising prices in response to excess demand helps firms manage the imbalance between supply and demand. By increasing prices, firms can balance the demand with their production capacity and avoid potential shortages.

Additionally, higher prices can also act as a signal to the market, encouraging consumers to adjust their consumption patterns and allocate their resources more efficiently. Ultimately, the decision to raise prices in this situation aims to ensure that the firm can sustain its operations, optimize revenue generation, and align supply with the heightened consumer demand.

Learn more about demand, below:

https://brainly.com/question/30692892

#SPJ11

Why did the Framers of the Constitution set up the legislative branch so difficult?

A: To prevent the constitution from being changed.

B: To make Congressmen work hard for the American people

C: To prevent authoritarian rule and make it so authoritarian laws do not pass

(Pick one please!)

Answers

Answer:

C

Explanation:

how are Northern Europe and Southern Europe similar.

Answers

Answer:

EU members share a customs union; a single market in which capital, goods, services, and people move freely; a common trade policy; and a common agricultural policy.

Which of the following does the Declaration declare? the answer is c

Answers

Answer:

The answer is C

Explanation:

China, Japan, North korea and South korea which is a presidential democracy

Answers

Answer:

im pretty sure its China but im not sure

Answer:

South Korea

Explanation:

The politics of the Republic of Korea takes in place in the framework of a presidential representative democratic republic, whereby the President is the head of state, and of a multi-party system. The government exercises Executive power and Legislative power is vested in both the government and the National Assembly.

What’s the answer????

Whats the answer????

Answers

Answer: bias

Explanation:

how does the analects of confucius compare with egypt's 42 negative confessions and babylon's law code of hammurabi? what values were common in egyptian, chinese, and babylonian society?

Answers

The Yellow and Nile Rivers were two more features of Chinese and Egyptian culture that were shared symbols, in addition to the Great Wall and the Pyramids of Giza.

What did Egyptian and Babylonian have in common?

In Confucius' Analects, there is The Analects of Confucius is a collection of aphorisms and historical tales that were compiled by Confucius' followers in the years after his death in 479 B.C.E. They represent the core principles of the Confucian tradition: learning, morality, ritual decorum, and filial devotion.

The list of 42 sins on The Negative Confession, often referred to as The Declaration of Innocence, is a list of offences that the deceased person's soul can sincerely claim to have never committed when it appears before God in the afterlife.

These were spoken by the soul in front of the gods, who judged one's fate based on how true they were.The Hammurabi code of laws, a collection of 282 regulations, established norms for business dealings and imposed fines and penalties to satisfy the demands of justice.

To learn more about Egyptian and Babylonian refer to :

https://brainly.com/question/1705438

#SPJ4

Comparing the stacked bar chart for 1900 to what you would expect for
the stacked bar chart for 2000, you would expect the height of the bar
representing light moths in the chart to (increase/decrease) and the
height of the bar representing dark moths to increase/decrease). *

Answers

Answer:yes 100000

Explanation:

Which of the following belongs in the box with the question mark?
A.
War of 1812
B.
Louisiana Purchase
C.
Constitutional Convention
D.
Declaration of Independence

Which of the following belongs in the box with the question mark? A. War of 1812 B. Louisiana Purchase

Answers

Answer:

Correct answer is C.  Constitutional Convention.

Explanation:

Option C is the correct answer as it related to process of creation of American Constitution, which started with the adoption of Articles of Confederation, which can be seen as a first constitution. Shay's Rebellion was an answer to Articles of those who were unsatisfied with them, but with the Constitutional Convention this crisis ended.

All other options are not parts of this line of events.

Other Questions
The force of friction oil an airplane in level flight is given by Ff = kv^2, where k is some constant, and v is the speed of the airplane. When the power output from the engines is P0, the plane is able to fly at a speed v0. If the power output of the engines is increased by 100% to 2P0, the airplane will be able to fly at a new speed given by (A) 1.12v0 (B) 1.26v0 (C) 1.41v0 (D) 2.82v0 (E) 8v0 If 40% is eliminated from 500 what is left over? The pipelined MIPS processor is running the following program.Which registers are being written, and which are being read on the fifth cycle?addi $s1, $s2, 5sub $t0, $t1, $t2lw $t3, 15($s1)sw $t5, 72($t0)or $t2, $s4, $s5So thats the problem, I understand what the code is doing but what are the registers being written and which ones are on the fifth cycle? Kind of confused. what is the most beautiful places in the PhilippinesGive 10: The Federal Reserve's Dual Mandate is to A. boost stock markets and keep borrowing rates as low as possible. B. achieve stable prices and maximum sustainable employment. OC.meet the goals of majority What do you already know about informative writing? Fill in the complementary DNA strand (template strand). Then transcribe \& translate these bacterial ORFs (open reading frame) from DNA sequence into mRNA / polypeptide. These are the non-template strands. 5'TCAATGGAACGCGCTACCCGGAGCTCTGGGCCCAAATTTCATTGACACT 3 ' 5GGGATCGATGCCCCTTAAAGAGTTTACATATTGCTGGAGGCGTtAACCCCGGA 3 An object with projectile motion constantly changes direction.TRUEFALSE he output is five less than triple the input A cylindrical well has a radius of 10 feet and a height of 15 feet. Whatvolume of water will it take to fill in the well? Does the president of the United States have to follow the laws of the country All the relevant forces inside a firm's boundaries, such as its managers, employees, and organizational culture, are part of its ______ environment. a legal document signed by the patient dealing with the types and extent of medical treatment the person wishes to have during the process of dying is called a (n) The moon is approximately 400,000 kilometers from Earth. The moon gets approximately 40 millimeters farther away from the earth every year. 1 millimeter is 1 x 10^-6 kilometers. In approximately how many years will the moon be twice as far from the Earth as it is now, assuming that nothing else changes? HELPPPPPPP HELPPPP Find the distance between the two points in simplest radical form.(4,2) and (1,4) Which of the following risks are dental assistants likely to encounter in theirday-to-day work?A. Allergic reactionsB. High-speed travelC. NeedlesO D. X-ray machines Blogging on a regular basis represents an enormous opportunity for growth and a far-reaching presence. How do organizations utilize blogs? a. To make job offers b. To create engagement c. To develop relationships d. To improve customer relations Internal communications. When wishing to acquire information from customers who use your products, which method would yield the best results? a. Wiki b. Blog c. Podcast Companies can use blogs to share late-breaking news of tidbits of interest to employees. This is an example of____________ Blogs take the same care and attention as other business writing. Please review the following sets of sentences and select the one that contains filler. Carmine Falcone is the founder of Forever Investment Group, or FIG, an investment management company with 39.2 million assets under management. FIG is getting very big, and Carmine has risen up the Forbes billionaires list every year because of the growth of his company. As of March 31, 2019, FIG had 908 asset management employees and 204 investment professionals, at our headquarters in New York and our affiliate offices around the globe. Mr. Falcone served as interim Chief Executive Officer from December 2011 to July 2013 and was appointed Chief Executive Officer in August 2013. Write a paragraph about a holiday that you do celebrate. Use facts within the supporting sentences to explain the holiday and the traditions that are associated with it. need help w this !! 10 era points if correct !!!