chromatin domain alterations linked to 3d genome organization in a large cohort of schizophrenia and bipolar disorder brains

Answers

Answer 1

Large clusters of hyper-acetylated CRDs with prominent representation of regulatory sequences governing foetal development and glutamatergic neuron signalling were enriched for SCZ heritability. Therefore, risk-associated regulatory sequences assembled into kilobase- to mega base-scaling chromosomal domains exhibit coordinated dysregulation in SCZ and BD brains.

The structure of the chromosomes in the human brain, from the 147-base pair (bp) nucleosome to megabase-ranging regions including several transcriptional units, including heredity loci for mental characteristics, is still mostly unknown. In this study, we generated H3-lysine 27 acetylation and H3-lysine 4 trimethylation profiles from 388 controls and 351 people with schizophrenia (SCZ) or bipolar disorder (BD) (n = 739). From these profiles, we constructed promoter- and enhancer-enriched nucleosomal histone modification landscapes for adult prefrontal cortex. Thousands of cis-regulatory domains (CRDs) were mapped, demonstrating fine-grained chromosomal structure of 104–106 bp that was tightly incorporated into Hi-C topologically associating domain stratification by open/repressive chromosomal settings and nuclear topography.

To know more about chromatin domain alterations, click here,

brainly.com/question/16319638

#SPJ4


Related Questions

Jay has type O blood, and his brother Alon has type AB blood. What are the genotypes of these boys' parents?

Answers

Answer:

The genotype of the boy's parents are Iᴬi and Iᴮi.

Explain the relationship between the Fossil Record and the Theory of Evolution.

(3 or more sentences)

Answers

Image result for Explain the relationship between the Fossil Record and the Theory of Evolution.
Fossils are important evidence for evolution because they show that life on earth was once different from life found on earth today. Paleontologists can determine the age of fossils using methods like radiometric dating and categorize them to determine the evolutionary. Hope this helps! Mark brainly pls!

The amount of water a body requires for survival is dependent upon the climate and the individual’s level of physical activity.

Answers

The statement "The amount of water a body requires for survival is dependent upon the climate and the individual’s level of physical activity" is true because these factors directly influence the body's water needs.

Climate affects the rate of water loss through sweating and evaporation. In hot and humid climates, individuals tend to perspire more, leading to increased water loss and higher hydration requirements. Similarly, physical activity increases the body's temperature and triggers sweating, resulting in additional water loss.

Engaging in exercise or laborious tasks amplifies the demand for water to replenish the fluids lost during perspiration. Neglecting to meet these increased water needs can lead to dehydration, impaired physical performance, and potential health risks, the statement is true.

To learn more about climate follow the link:

https://brainly.com/question/3122713

#SPJ1

The correct question is:

The amount of water a body requires for survival is dependent upon the climate and the individual’s level of physical activity.

True or False

At which temperature do particles stop moving entirely?
O A. 32 K
O B. 32°F
O C. OK
D. 0°C

Answers

0K

explanation:

0 kelvin (273 degrees celsius)
The motion of particles will stop at 0 K, or -273.15 C.
So C. Would be correct.

List three ways to keep the environment clean

Answers

Reduce, reuse, recycle

Reduce: Use plastic less
Reuse: Reuse plastic bags and paper bags when going to the store
Recycle: Recycle food, garbage, and paper into different containers

What is food intolerance?
A. it is food poisoning
B. it is the body's inability to process fat
C. Is is the body's inability to process certain types of food
D. it is another word for food allergy

Answers

Answer:

C

Explanation:

A food intolerance is when you have difficulty digesting certain foods or ingredients in food. It's not usually serious, but eating the food you're intolerant to can make you feel unwell.

\(ANSWER\)

C.

Explanation:

Food intolerance is the body's inability to process certain types of food.

hope it helps

Which is the best example of a hypothoses leading to a new experamental methods

Answers

Answer:

The best example of hypothesis which leads to new experiment methods was done by Morgan where he used fruit flies.

Answer:

need the options without them all I can say is the best expermental method tend to come from trying to prove as well as disprove your hypothesis. by doing conducting a study completely unbiased from the hypothesis you can collect better precise data in experiments

Create a food chain that shows the energy transfer from the sun to a grizzly bear. Include four transitions (arrows) in your food chain.

Answers

1. The sun - plants - caterpillar - fish - bear
(I already answered but ima answer again)

Answer:

THE FOOD CHAIN IS SUN-PLANTS-CATAPILLAR-FISH-BEAR

Explanation:

srry forgot caps was on hope this help yw

Which of the following is NOT a true statement about soil microorganisms? A. Microorganisms can be used for medicinal purposes. B. Microorganisms can use oxygen, sulfur, iron or nitrogen to respire. C. Microorganisms can cause disease in plants, animals and humans. D. Microorganisms cannot decompose organic matter.

Answers

Answer:

b

Explanation:

b

HURRY HELP!!! IMPORANT!!!

Drag each title to the correct box.

Arrange the steps of mitosis in the correct order.

*please give the order of the answers going bottom to top like the table shown in the image*

HURRY HELP!!! IMPORANT!!!Drag each title to the correct box.Arrange the steps of mitosis in the correct

Answers

THE ANSWER ABOVE IS WRONG!!! The correct answer is 3-interphase 4-metaphase 1-anaphase 2-telephase

Answer:

3-interphase 4-metaphase 1-anaphase 2-telephase

Explanation:

plato

9. Look at the large permanent vacuole in the plant cell. Based on the shape of it and it being in a plant cell, what
do you think its role is?

Answers

Answer:

Vacuoles are storage bubbles found in cells. They are found in both animal and plant cells but are much larger in plant cells. Vacuoles might store food or any variety of nutrients a cell might need to survive. They can even store waste products so the rest of the cell is protected from contamination. Eventually, those waste products would be sent out of the cell.

Explanation:

the side with ____________ solutes to the side with __________ solutes.

(active transport)

Answers

Answer:

The side with more solutes to the side with fewer solutes.

Explanation:

Uses the concept of diffusion.

HOPE THIS HELPED

Compare a porifera with an earthworm. What are their similarities and differences. And how they relate to each other. Like kingdom, family, phylum, class, etc.

Answers

Porifera and earthworms are different in physical characteristics and habitat, but both are multicellular and belong to the Animalia kingdom.

Porifera and worms are two totally different creatures with unmistakable qualities and elements. Porifera, otherwise called wipes, have a place with the phylum Porifera, while worms have a place with the phylum Annelida. Porifera need genuine tissues and organs and are sessile channel feeders that live in oceanic conditions, while night crawlers are fragmented worms that live in soil conditions, with a stomach related framework and a sensory system.

In spite of these distinctions, Porifera and night crawlers share a few similitudes. Both are multicellular creatures with specific cells and tissues, and they have a place with the realm Animalia. Furthermore, the two of them assume significant biological parts in their particular surroundings.

To learn more about Porifera, refer:

https://brainly.com/question/19339954

#SPJ1

What organs/systems is affected by the sympathetic nervous system but is NOT affected by the parasympathetic nervous system?

Answers

Answer: cellular metabolism

Explanation:

Cellular metabolism is chemical reactions that takes place in living organisms so that they will be able to maintain life. Cellular metabolism is made up of thousands of genes, metabolites and proteins.

Cellular metabolism is affected by the sympathetic nervous system but is not affected by the parasympathetic nervous system.

The diagram below shows a cross section view of a flower.

What is the function of structure Y?
A.
to attract pollinators to the flower
B.
to form the floral organs
C.
to attach the flower to the main stem
D.
to protect the developing bud

The diagram below shows a cross section view of a flower.What is the function of structure Y? A. to attract

Answers

Answer: Flowers are the reproductive organs of angiospermophytes (flowering plants) and contain male and female structures most flowers possess both male and female structures (monoecious), but some may only possess one structure (dioecious)

Explanation: so the answer is A.

How are rocks and air alike? A. People use them to build things. B. They are on the ocean floor. C. They are natural resources. D. People need them to live.​

Answers

Answer:

i think its c

Explanation:

Answer: C.

Explanation: Natural resources are resources that exist without any actions of humankind. Basically materials or substances such as minerals, forests, water, and fertile land that occur in nature and can be used for economic gain. Rocks are a source of natural resources and so is air. If the answer is not correct, then it must be D.

Which of the following common functional groups in biomolecules is NOT capable of multiple protonation states?

Methyl
Hydroxyl
Amino
Sulfhydryl

Answers

The common functional groups in biomolecules that is NOT capable of multiple protonation states is methyl.

Multiple protonation states refer to the ability of certain functional groups in biomolecules to accept or donate more than one proton in a solution.

Methyl (-CH₃) is not an acidic or basic group and does not have any ionizable protons. It is a nonpolar hydrophobic group that is often found in biomolecules as a component of larger functional groups, such as methyl groups attached to nitrogen atoms (e.g. in the amino acid alanine) or oxygen atoms (e.g. in the methyl group of methylated DNA bases).

In contrast, hydroxyl (-OH), amino (-NH2), and sulfhydryl (-SH) functional groups are all capable of multiple protonation states.

Hydroxyl groups can act as weak acids and donate a proton to form an oxyanion, while amino and sulfhydryl groups can act as weak bases and accept a proton to form positively charged ammonium and thiol groups, respectively.

The ability of these groups to accept or donate protons is important for their biochemical roles, such as in enzyme catalysis and protein folding.

Learn more about functional groups here: https://brainly.com/question/15013700

#SPJ4

How are plant and animal structures similar? How are they different?

Answers

Answer: Plant and Animal cells are similar in the following way, Both have Nucleus Both are Eukaryotic, and Both are walled with a Cell Membrane. They are different as the such, Plants have Cell walls while Animals do not, Plant cells are Autotrophs  while animals are heretrophs. Plants have chloropast while animals do not.  

Explanation:

Help please don’t understand this. Will give brainliest!

Help please dont understand this. Will give brainliest!

Answers

Correct Answer:
Stabilising Selection.

Explanation:
Birth weight is a classic example of a trait under strong stabilizing selection, where high and low birth weights are correlated with reduced survival in both males and female.

How many amino acid differences would you expect to find between the hemoglobin of a human and a wolf?

Answers

Answer:

600! IF THIS ISN'T IT IM SO SORRY

Explanation:

3.2
Describe the tendency of population movement in South Africa over
the same 50-year period.
3.1.3 What influence does this population shift have on agriculture?

Answers

Overall, the population shift in South Africa has had a negative impact on agriculture, leading to a decline in the sector and decreased food security for rural communities.

What is population?

Population refers to the total number of individuals of a particular species or group living in a specific area or region. In the context of human populations, it refers to the number of people living in a particular geographic area or country. Population can also refer to subgroups within a larger population, such as age groups, ethnic or racial groups, or socioeconomic groups. Population can be measured and analyzed in various ways, including through demographic data such as birth and death rates, migration patterns, and population density.

Here,

Over the past 50 years, there has been a significant population shift in South Africa, with many people moving from rural areas to urban areas in search of better economic opportunities, education, and healthcare. This trend is known as urbanization and is a common phenomenon in many developing countries.

As people move from rural areas to urban areas, the population density in urban areas increases, while rural areas become less populated. This population shift has had a significant impact on agriculture in South Africa. As more people move to cities, there is less demand for agricultural products, leading to a decline in the agricultural sector. This has resulted in the loss of agricultural land, reduced productivity, and decreased food security for rural communities.

In addition, the population shift has also led to changes in land use. As urban areas expand, they often encroach on agricultural land, leading to land fragmentation and reduced agricultural productivity. This can also lead to conflicts between urban and rural communities over land use and resource allocation.

To know more about population,

https://brainly.com/question/27459270

#SPJ1

One of the MOST important Ds in the 6 Ds of Behavior Change is...

Answers

One of the most important Ds in the 6Ds of behavior change is the preparation stage.

A behavioral change is regarded as a shift in an individual's conduct as compared to prior behavior and can be either temporary or permanent. According to the transtheoretical model of behavioral changes, the 6Ds include pre-contemplation, contemplation, preparation, action, maintenance, and relapse or termination.

People are not thinking about changing when they are in the precontemplation stage. People learn more and more about the potential advantages of changing during the contemplation stage. You might start making minor adjustments in the planning stage to get ready for a bigger change in your life. The fourth stage of change is when people start acting directly to achieve their objectives. The Stages of Change model's maintenance phase focuses on successfully avoiding old behaviors and maintaining new behaviors. You could feel like a failure, disappointed in yourself, and frustrated when you relapse. One can avoid relapse through effective practices.

Thus, the most important stage is the preparation stage. People skipping this step to adopt behavior change are more likely to relapse within 21 days.

To know more about behavioral change, refer to the following link:

https://brainly.com/question/25816978

#SPJ9

describe the arramgement and motion particals in
a)solid
b)liquid
c)gas​

Answers

Answer:

Particles in a: gas are well separated with no regular arrangement. liquid are close together with no regular arrangement. solid are tightly packed, usually in a regular pattern.

In a solid, the particles pack together as tightly as possible in a neat and ordered arrangement. The particles are held together too strongly to allow movement from place to place but the particles do vibrate about their position in the structure.

The particles in a liquid have small spaces between them, but not as small as in solids. The particles in a liquid are loosely arranged which means they do not have a fixed shape like solids, but they rather take the shape of the container they are in.

Answer:

\(-solids\)

\(soilds\:are\:the\:particles\)

\(which\:can\:stay\:like\:sticky.\)

\(and\:molecules\:stays\:each\:other\)

Examples :-

chalkEraser duster

\(-liquids\)

\(liquids\:are\:the\:particles\)

\(which\:can\:flow\)

\(and\:particles\:having\:literally\:space\)

Examples :-

water cool drinks milk

\(-Gases\)

\(Gases\:are\:the\:particles\)

\(which\:can\:evaporates\:easily\)

\(and\:particles\:stays\:foraway\)

Examples :-

perfume smoke

\(hopes\:it's\:helps\:you\)

Please give earths layers

Please give earths layers

Answers

Note that the layers of the earth as proposed in the image given are:

1- Exosphere

2 - Thermosphere

3 - Mesosphere

4- Stratosphere

5 - Atmosphere

6 - Troposphere

7  - Asthenosphere

8 - Inner Core

9 - Mantle

10 - Lower mantle.

What is the Mesosphere?

The mesosphere is the third layer of the atmosphere, located just above the stratosphere and under the thermosphere. Temperature falls as altitude climbs in the mesosphere.

The troposphere is the Earth's initial and lowest layer of the atmosphere, containing 75% of the entire mass of the continental atmosphere, 99% of the total mass of water vapour and aerosols, and is the location of most meteorological occurrences.

Learn more about the Asthenosphere:
https://brainly.com/question/7152935
#SPJ1

Name three different factors from Your plan. My Planet. , actions or specific human activities that contribute to the negative environmental impact in your selected area.

Answers

In the context of "My Planet" as the selected area, here are three different factors, actions, or specific human activities that contribute to the negative environmental impact:

1. Deforestation: The clearing of forests for various purposes, such as agriculture, logging, and urbanization, has a significant negative environmental impact. Deforestation contributes to habitat loss, biodiversity depletion, soil erosion, and carbon emissions, which exacerbate climate change.

2. Pollution and waste: Human activities that result in pollution and waste generation have detrimental effects on the environment. This includes air pollution from industrial emissions and vehicle exhaust, water pollution from industrial and agricultural runoff, and improper disposal of waste materials. Pollution and waste can harm ecosystems, contaminate water sources, endanger wildlife, and contribute to climate change.

3. Overconsumption and resource depletion: Unsustainable patterns of consumption, driven by excessive demand for goods and resources, have a negative environmental impact. Overconsumption leads to the extraction of finite resources beyond sustainable levels, such as minerals, fossil fuels, and freshwater. It also contributes to the generation of waste, energy consumption, and greenhouse gas emissions associated with the production, transportation, and disposal of goods.

These factors and actions collectively contribute to the degradation of ecosystems, loss of biodiversity, climate change, and other environmental challenges that can negatively impact "My Planet." It is crucial to address these issues through sustainable practices, conservation efforts, and responsible consumption to protect and preserve the environment for future generations.


A single gene with two alleles control variation in haemoglobin type in sheep. There are three different phenotypes corresponding to genotypes S^AS^A S^AS^B and S^BS^B respectively in a flock of 175 sheep the frequency of allele S^A was found to be 0.6 and frequency of allele S^B WAS found to be 0.4

Answers

Populations in Hardy-Weinberg equilibrium express the same allelic and genotypic frequencies through generations. Number of individuals expressing each phenotype: 63 sheep S^AS^A, 84 sheep S^AS^B, 28 sheep S^BS^B.

What is Hardy-Weinberg equilibrium?

The Hardy-Weinberg equilibrium theory states that allelic and genotypic frequencies in populations that is in equilibrium remain the same through generations. No evolutive forces are acting on these populations, so no evolution occurs.

Assuming a diallelic gene,

Allelic frequencies

The frequency of the dominant allele f(X) is pThe frequency of the recessive allele f(x) is q

Genotypic frequencies

p² (Homozygous dominant genotypic frequency), 2pq (Heterozygous genotypic frequency), q² (Homozygous recessive genotypic frequency).

The addition of the allelic frequencies equals 1

p + q = 1.

The sum of genotypic frequencies equals 1

p² + 2pq + q² = 1

In the exposed example,

Alleles          Frequencies

S^A      f(S^A) = p = 0.6S^B      f(S^B) = p = 0.4

Genotypes

S^AS^A ⇒ homozygousS^AS^B ⇒ heterozygousS^BS^B ⇒ homozygous

We need to get the number of animals expressing each genotype and phenotype. To do it, we just need to use allelic frequencies and calculate  genotypic frequencies (p², 2pq, and q²), and then multiply these values by the total number of animals (N = 175).

Genotypic and Phenotypic frequencies

F(S^AS^A) = p² = 0.6² = 0.36

F(S^AS^B) = 2pq = 2 x 0.6 x 0.4 = 0.48

F(S^BS^B) = q² = 0.4² = 0.16

Number of individuals expressing each phenotype

S^AS^A ⇒ 0.36 x 175 = 63 individualsS^AS^B ⇒ 0.48 x 175 = 84 individualsS^BS^B ⇒ 0.16 x 175 = 28 individuals

You can learn more about the Hardy-Weinberg equilibrium at

https://brainly.com/question/16823644

#SPJ1

Complete question

A single gene with two alleles control variation in haemoglobin type in sheep. There are three different phenotypes corresponding to genotypes

S^AS^A S^AS^B and S^BS^B

In a flock of 175 sheep the frequency of allele S^A was found to be 0.6 and frequency of allele S^B WAS found to be 0.4.

Using the hardy weinberg equation calculate the number of sheep with each phenotypes in the flock show your working

Use your codon chart to determine the amino acid sequence. Remember to read through the strand and ONLY start on AUG and STOP when you reach a stop codon (UGA, UAA, or UAG). Follow the example in the box. Abbreviate the proteins using the first three letters of the amino acid name.

Answers

Methionine (AUG)Amino acids can be abbreviated using the first three letters of their name.

Methionine can be abbreviated as Met.

The given RNA sequence is AUGUAACGAUGCGUCGUGGCAUCAUGCUGCGUCAGCGGCGAGUCUGACCCGUCUCUAACAGGACGGCCGGGCGUUGUCGUUGA.

We can use the codon chart to determine the amino acid sequence.

The codon chart is used to determine which amino acid is coded by a particular codon in a strand of DNA/RNA.A codon is a sequence of three nucleotides in DNA or RNA that encodes for a specific amino acid.

Each codon codes for a different amino acid.

For example, the codon AUG codes for the amino acid methionine.

To determine the amino acid sequence, we start reading the RNA strand from the start codon AUG and continue reading until we reach a stop codon (UGA, UAA, or UAG).

Then we write down the amino acid sequence for the codons we read, using the codon chart.

Here, the sequence starts with AUG, which codes for methionine.

After that, the next codon is UAA which is a stop codon, so we can stop.

The amino acid sequence is therefore Methionine. So, the answer would be Methionine (Met).

For more such questions on Methionine

https://brainly.com/question/29481268

#SPJ8

Question b OT 15
Ain
force is the overall force on an object after all the forces
are added together.

Answers

Answer:

The correct answer is - Net force.

Explanation:

Adding all the forces that are applied to a particular object, body, or particle is the net force. This overall force that is applied can be calculated by a vector sum of all other forces exerted on the body.

So if two forces are applied in opposite directions to one another, they combine by subtraction whereas If one force is less than the other force, the net force is in the direction of the greater force.

what describes when energy is released from an ATP molecule?

Answers

Answer:

hydrolysis

Explanation:

The process of hydrolysis is when one phosphate group is removed by breaking a phosphoanhyride bond. Then energy is released and ATP converts into ADP.

SOMEONE HELP ME WITH THIS QUESTION

SOMEONE HELP ME WITH THIS QUESTION

Answers

Answer:

rrkufhjgfyrugf5td89yed/learningnice.com/ffiuvfk/answer

Explanation: there:)

Other Questions
The actor's final performance was galvanizing; as a result, everyone in the audience was mesmerized. Which type of context clue would you use to determine the meaning of galvanizing?. it is generally more advantageous from a tax perspective for a married couple to file separately than it is for them to file jointly.truefalse The Haymarket Affair greatly increased public support for labor unionsTrueFalse Solve for the indicated variable. Include all of your work in your answer. Submit your solution.A = 1 + prt; for r I just need a quick answer on this one. No need for an explanation! In the equation x square + 5x - 14 =0, the solutions are? Choose two events in the Odyssey: 0ne event from Part 1 and one event from Part 2. Think about these events and select a song that would best go with the event on a movie soundtrack. Write the song title and artist. Then write a paragraph explaining how the song would best go with the event you chose.Paragraph requirements:Must be 4-8 sentences in each paragraphMust show clear details and understanding of event chosenMust have one event from Part 1 and one from Part 2Must have text evidence either from the Odyssey or song to show evidence on why you chose the songMust clearly explain why you chose the song and how it connects to the eventYou CANNOT choose a song already used in an Odyssey film or TV versionCheck spelling and grammarHELPP THIS IS DUE 11:59 TONIGHT A company is investing $800,000 to add a new machine to its production line. The installation cost is $20,000. The machine will be sold at the end of year 3 for $600,000 before taxes. The equipment purchase falls under the three year MACRS depreciation schedule ( 33.33%, 44.45%, 14.81%, 7.41%). The tax rate is 30%. What is the after tax selling price of the machine? in year 3a. $600,000b. $438,229c. $420,547d. $490,650e. None of the above 0.175 moles of calcium nitrate are dissolved in a total of 50.00 ml of solution. a) calculate the molarity of the solution. b) how many grams of calcium nitrate are dissolved in this solution? you buy a bond with a $1,000 par value today for a price of $825. the bond has 5 years to maturity and makes annual coupon payments of $65 per year. you hold the bond to maturity, but you do not reinvest any of your coupons. what was your effective ear over the holding period? Generally, the wealthiest and most developed nations in the world are located in the Northern Hemisphere. Group of answer choices True False Compute the partial sums S2,S4, and S6.2+2/2^2+2/3^2+2/4^2+S2=S4=S6= Given tan a = ; and that angle a is in quadrant i, find the exact value of cos a in simplest radical form using a rational denominator. 9 4 1. What are sime of the environmental factors whoch influence the rate of transpiration?2. Discuss the advantages and disadvantages of the transpiration process in plants.3. What sttategies have evolved by which plants are able to reduce their transpiration rates and thus conserve water?4. What tissue/s did you find the dye along the stem? what is the meaning of student unrest Universal Bhd had a debit balance of RM56,500 in the cashbook on 31 December 2021. The Bank Statement received for the month showed a credit balance of RM76,710. On comparing the cashbook with the Bank Statement, the following were discovered: 1. A deposit entry of RM19,500 which appears in the cashbook at 31 December 2021 had not yet been credited in the bank statement. 2. The bank had collected on the firm's behalf a check for RM30,360 being proceeds of a sale. 3. A check amounting to RM10,500 which was recorded as a receipt in the cashbook was returned to the firm by the bank, stamped with the word 'insufficient funds'. 4. The last check entered in the cash payment, No 1234, for RM3,630 appears in the bank statement as RM3,600. An examination of the cashbook reveals that the bank figure is correct. 5. Check No 1236 for RM3,180 has been correctly debited in the bank statement but not shown in the cashbook of the firm. Page 2 of 4 CONFIDENTIAL 202204/SEM103/A What is the periodic table of elements (Ill give you brainiest)The land in the west part ofChina is less fertile and poorer for farming than the lands in the part of China.A, industrialB. newerC. eastD. none of the above the general name for the medium through which a message is transmitted is the PLEASE HELP!!!! THIS IS DUE IN AN HOUR! Also please dont give me the wrong answer. I will know if u do especially if u do it just to get points.. Please dont troll me or anything like that.. Reflect the point (2,-4) over the y-axis. what are the new coordinates of that point after the reflection?A. (2,4)B.(-2,4)C.(-2,-4)D.(-4,2)