Answer:
primary structure of protein sometimes after the surgery structures of the protein synthesis answer
Genetic diversity decreases the more species there are in an area. True or False
Answer:
False. Genetic diversity tends to increase as the number of different species in an area increases. This is because diverse habitats support a wider range of ecological niches, which in turn support a greater variety of species and genetic diversity within those species. However, it's worth noting that other factors such as habitat fragmentation, invasive species, and climate change can also affect genetic diversity in complex ways.
Explanation:
If glucose is metabolized under completely anaerobic conditions, pyruvate ( Please explain why each answer is wrong or right.)
a. immediately enters the Krebs cycle.
b. is converted by fermentation to lactate or CO2 and ethanol.
c. is converted back to fructose until the concentration of oxygen increases.
d. is converted to NADH.
Answer:
B.
Explanation:
A is wrong because pyruvate would enter the Krebs cycle under aerobic condition (when oxygen is present). Hence the name aerobic cellular respiration
C. I do not really too much about fructose or the concentration of oxygen, but I can assure that this answer choice is not correct.
D is wrong because NADH would be converted from NADP+. Either with oxidation or reduction, and this helps to keep this process going.
B is correct because fermentation is another word for anaerobic cellular respiration. The process takes place with the absence of oxygen. It either goes through Alcoholic or lactic acid fermentation.
I hope this helps!
24. When does evolution occur?
O when the Hardy-Weinberg equilibrium is reached
Owhen the DNA mutates in an individual
O when the allele frequency changes
O when an individual migrates to a new place
Answer:
Option 3
Explanation:
Evolution occurs when the allele frequency changes.
What would happen if ligase were absent?
DNA ligase is involved in DNA repair, DNA replication. They are also involved in crossover in meiosis in eukaryotes and in recombination processes in mammals that ensure the diversity of the immune system. DNA ligase enzyme is used in recombinant DNA applications in molecular biology laboratories..good luck...
Javier decides to test which type of fertilizer works best on his begonias, which are a type of flower. He sets up flowers in 20 pots and divides them into groups of five. He waters three of the groups with three different brands of fertilizer and the last group with plain water. After 2 weeks, he measures how much each plant has grown.
Based on the information provided above, identify the following:
1 What is the dependent variable in this experiment?
2 What is the independent variable in this experiment?
3 What is the control group in this experiment?
this is due today please answer for me
Based on the information provided above, the dependent variable is the height of each plant with respect to each fertilizer. The utilization of fertilizer is an independent variable. While the last group that Javier treated with plain water is the control group in this experiment.
What is an Independent variable?An independent variable may be defined as a type of variable that significantly stands alone and isn't altered by the other variables you are trying to determine. These types of variables do not depend on other factors during the course of an experiment.
According to the experiment conducted by Javier, the growth of the plant directly depends on the type of fertilizer and it may vary with respect to each fertilizer. So, it is considered under the dependent variable.
The utilization of fertilizer does not depend on any factor during the course of the experiment. So, it is classified under an independent variable. While the group of plants that do not have any interaction with fertilizers and are treated normally comes under the category of control groups.
To learn more about Independent and dependent variables, refer to the link:
https://brainly.com/question/28433016
#SPJ1
We would expect clouds of type _______ to form above heights meters (high elevation) and be made of ice crystals.Question 20 options:ABCD
Cirrus clouds are short, detached, hair-like clouds found at high altitudes. These delicate clouds are wispy, with a silky sheen, or look like tufts of hair. In the daytime, they are whiter than any other cloud in the sky. While the Sun is setting or rising, they may take on the colours of the sunset.
Answer: C
You are undertaking a research project that involves determining the cellular location of a particular jellyfish protein in a number of individuals. The protein that you are studying normally is transported to the mitochondria. However, in a recent collection you notice one individual who had the protein remain in the cytoplasm (not transported to the mitochondria). What alteration in this individual could explain this observation?
Answer:
May be mutation.
Explanation:
This observation indicates that mutation occurs in the body of that Jelly fish because that jelly fish is unable to transport the protein from cytoplasm to the mitochondria like other jelly fishes. This change occur in the genetic makeup of that jelly fish or may be lack of a hormone that is responsible for the transportation of that protein from cytoplasm to mitochondria.
Need help with this please and thank you Question A
These percentages are the same because in the double helix of the DNA, the nitrogenous bases of each nucleotide of one strand bind via hydrogen bond to the nitrogenous base in front of it in the other strand of the DNA. This union is not random, adenine only binds with thymine and cytosine only binds with guanine, and that's why their percentages match.
Cuál es el órgano más grande del cuerpo humano
Answer:
Explanation:
La piel
Answer:
The skin is often known as the largest organ of the human body. This applies to the exterior surface, as it covers the body, appearing to have the largest surface area of all the organs. Moreover, it applies to weight, as it weighs more than any single internal organ, accounting for about 15 percent of body weight.
Explanation:
Use the drop-down menus to complete each sentence.
are organisms that contain more than one cell with membrane-bound organelles and a nucleus.
Organisms that contain only one cell and do not contain a nucleus or membrane-bound organelles are known as
Answer:
✔ Eukaryotes
are organisms that contain more than one cell with membrane-bound organelles and a nucleus.
Organisms that contain only one cell and do not contain a nucleus or membrane-bound organelles are known as
✔ prokaryotes
Explanation:
1. Eukaryote
2. Prokaryote
why is sustainability a problem in agriculture crops ?
Which of the following is closest to the weight in Newtons of a 20 kg
object on the Earth's surface? g = 10 m/s2
a 200N
b 400N
C 20 N
d 350 N
Answer:
AHHHHH LESLIE
Explanation:
BAHHAHAIRIDJ WHY HE ASIGN THIS SHII IT DONT MAKE SENCEEE
Answer:
200n is the answer
Explanation:
ur welcome
List three ways to keep the environment clean
make an informational sign to display at the nasa educational exhibt explaining punnett squares and probabilty to the public your sign should show the genotypes and phenotypes of the parents it should also explain why this pair was selected also be sure to include the appriote punnett squares to show the predictions for the possible offspring
Welcome to the NASA Educational Exhibit! Today we'll be discussing Punnett squares and probability.
What is Genetics ?Genetics is the study of how traits are passed from parents to their offspring. Punnett squares are used to predict the probability of inheriting certain traits. For this exhibit, we've selected a pair of parents, one with straight hair and one with curly hair.
The genotypes of the parents are:
Straight hair parent: SS (homozygous dominant)
Curly hair parent: ss (homozygous recessive)
The phenotype of the parents are:
Straight hair parent: Straight hair
Curly hair parent: Curly hair
We selected this pair because they both have very different hair types, and hair type is a trait that is easy to see and identify.
Let's use a Punnett square to predict the possible offspring of these parents. The Punnett square below shows the possible combinations of alleles that could result from their mating .
As you can see from the Punnett square, there is a 50% chance that the offspring will have straight hair (genotype: Ss), and a 50% chance that the offspring will have curly hair (genotype: ss).
In summary, Punnett squares can help us predict the probability of inheriting certain traits. By understanding genetics and probability, we can learn more about the world around us and make informed decisions about breeding and genetic disorders.
To know more about Punnett square , visit :
https://brainly.com/question/27984422
#SPJ1
Scientists were studying temperature selection amongst pregnant big brown bats. What would be the best control group for this study? a. pregnant bats b. female bats that were not pregnant c.male bats d. juvenile male bats e.juvenile female bats
What does Oort define in our solar system
The flocks all started with 10 birds. Flock
✔ Y
was the most successful at feeding, so it will have the greatest number in the second generation. Flock
✔ X
was the least successful at feeding and has shrunk the most.
t is likely that the most successful flock, Flock Y, was able to provide better nutrition and care for its birds, leading to better survival rates and higher reproductive success. As a result, the offspring of Flock Y would likely have a greater chance of surviving and reproducing themselves, leading to a larger second generation.
Conversely, Flock X was the least successful at feeding, which likely led to higher mortality rates and lower reproductive success. As a result, the offspring of Flock X would likely have a lower chance of surviving and reproducing, leading to a smaller second generation.
When a plant generates food through photosynthesis, this food
A.
is always used as soon as it is converted into a form the plant can use.
OB
can be used immediately or stored for later use.
C.
can cause the plant to gain excess layers of fat.
OD
is stored for a short period of time, usually about three weeks,
Answer:
B:because plant will make the food,store it,or eat it.usually the plant will stored the food for the winter,because of the soil being frozen and barely any sunlight,it will make it hard for the plant to make more food during photosynthesis,sometimes the plants will die but come back when it is springtime.Once food is made it is used or saved for later use for energy.
Answer:
can be used immediately or stored for later use.
Explanation:
Energy generated through photosynthesis can be used immediately or stored for later use depending on the needs of the plant in its environment.
Sometimes, a plant needs to immediately put this energy into growing new branches or leaves. Other times, such as when a cold winter is approaching, it might be better for the plant to store the energy for later use
What are two kinds of chemical properties of matter? (select all that apply)
ability to shine
ability to burn
ability to bend
ability to rust
(NO LINKS PLS)
Answer:
ability to rust, ability to burn
Explanation:
Ability to rust and burn are both chemical properties cuz both require reacting with oxygen/moisture to form.
Shining and bending are physical properties cuz you can just observe them without any reaction.
https://chem.libretexts.org/Courses/University_of_British_Columbia/CHEM_100%3A_Foundations_of_Chemistry/03%3A_Matter_and_Energy/3.05%3A_Differences_in_Matter%3A_Physical_and_Chemical_Properties
What is A Brain? Write its parts name. and explain .
Answer and Explanation:
The brain is composed of three main structures, the cerebrum, cerebellum, and brain stem. The brain sends chemical and electrical signals throughout the body to regulate different biological functions and sense environmental changes. The brain communicates with the majority of the body through the spinal cord.
what name do we use for the outer membrane of skeletal muscle cells?
a. sarcoplasmic
b.sarcoplasm
c.sarcolemma
d.sarcasm
Answer:
The answer is sarcolemma
What is the allele number for the following sequence? (3pts)
GTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCA
Answer:
what I don't understand what is the Ctcagt
Many whole families died when the plague hit Europe. Since the bite of a flea was the main transmission of plague, how did it MOST likely spread to the rest of the family?
A.
Every person would have to be bitten by an infected flea.
B.
The plague was passed through contaminated water and sewage.
C.
If the family were in close contact with the sick person’s boils, they could get the bacteria.
D.
If the plague had spread to the lungs and a person coughed, it could spread to others.
In crude oil affect eggs and larvae of fish and increase mortality.
O a.
Hydrocarbon
O b.
PAH
O c.
liquid petroleum
Answer:
its c liquid petroleum 100% surr
Experiment to use to show that plants get energy from air soil water
An experiment to show that plants get energy from air soil and water is to place pants into different types of air soil and water conditions and observe the outcomes of these independent variables on the plant growth, which in this case would represent the dependent variable to be measured.
What does an experimental science procedure mean?An experimental science procedure is any class of process used to test a hypothesis during a scientific investigation, which involves collecting data to accept or reject this plausible explanation.
An experimental science procedure is based on different types of variables that remain unchanged (independent) and those dependent variables that are modified along with the experiment.
Therefore, with this data, we can see that an experimental science procedure is based on the placement of the subject of an investigation under different conditions in order to collect data and make assumptions about the outcomes.
Learn more about experimental procedures here:
https://brainly.com/question/17274244
#SPJ1
The molecule below is
Answer:
e
Explanation:
What is the steps to create a slide show in Tux Paint?
Answer:
Step 1: Click the Open tool on the toolbar. A list of saved pictures appears. Step 2: Click the Slides button present at the lower left of the list. Step 3: Click the desired pictures one by one in the order in which you want them to appear in the slide show.Explanation:
hope its help
recal what you know about the functions of the skeletal system to complete the following questions
The skeleton provides a framework for ⇒ muscle and soft tissue attachment.
Name one organ protected by the ribcage. ⇒ Heart, lungs, liver
Blood is formed in the:
red bone marrow.Calcium is released and deposited in the bones and blood to maintain homeostasis. calcium, phosphorus, minerals, fat is stored in the bones.When muscles: ⇒ contract, the bones attached to them move.
What is the skeletal systemThe bony structure of the skeleton serves as a foundation for providing support and attaching soft tissues. The heart is safeguarded by the ribcage.
The bone marrow is responsible for producing blood. In order to keep the body in balance, calcium is discharged and stored in both the bloodstream and bones. The bones serve as a storage site for calcium. The movement and locomotion of the body occurs as a result of bones connected to contracting muscles.
Learn more about skeletal system from
https://brainly.com/question/16215740
#SPJ1
See full text below
Recall what you know about the functions of the skeletal system to complete the following questions. The skeleton provides a framework for and soft tissue attachment. Name one organ protected by the ribcage. Blood is formed in the bone marrow. is released and deposited in the bones and blood to maintain homeostasis. is stored in the bones. When muscles , the bones attached to them move.
Through a published schedule and set of guidelines, the Centers for Disease Control and Prevention (CDC) and public health officials recommend that every child receive certain vaccinations by age 6. What are the benefits of this recommendation to public health officials, to the community and to other children?
Answer: to ensures your baby's immune system gets the help it needs to protect your child long-term from preventable diseases. Not vaccinating your child on time can make someone else sick.
Explanation: hope this helps
The benefits of the recommended vaccination schedule include improved public health, reduced disease transmission, protection for vulnerable populations, and prevention of outbreaks.
What is vaccination?Vaccination, also known as immunization, is a medical process that involves the administration of a vaccine to stimulate the immune system and provide protection against specific infectious diseases. Vaccines are composed of weakened or killed pathogens, parts of pathogens, or harmless components that resemble pathogens. When a vaccine is introduced into the body, it triggers an immune response, stimulating the production of antibodies and the activation of immune cells.
The primary goal of vaccination is to prevent diseases and their complications. By receiving vaccines, individuals develop immunity to specific pathogens, making them less susceptible to infection. Vaccination not only protects the vaccinated individual but also contributes to public health by reducing the spread of infectious diseases within communities. This concept, known as herd immunity, occurs when a significant portion of the population is immune, preventing the sustained transmission of a pathogen and safeguarding those who cannot receive vaccines due to medical reasons or being too young.
Overall, vaccination has been one of the most successful and cost-effective public health interventions, saving countless lives and significantly reducing the burden of infectious diseases worldwide
Learn more about vaccination, here:
https://brainly.com/question/30971624
#SPJ2
What part of the brain is the arrow pointing to in the diagram?
Answer:
The Occipital Lobe
Explanation:
The Brain is the part of the central nervous system enclosed in the cranium of humans other vertebrates, consisting of soft, convoluted mass of gray and white matter and serving to control and coordinate the mental and physical actions.
The Occipital Love is the most posterior love of each cerebral hemisphere, behind the parietal and temporal lobes.