A gas with a volume of 5.64 L at a pressure of 0.73 atm is allowed to expand until the pressure drops to 0.1 atm. What is the new volume?


anwser:

Answers

Answer 1

When a gas with a volume of 5.64 L at a pressure of 0.73 atm is allowed to expand until the pressure drops to 0.1 atm, the new volume is 41.41 L

According to Boyle's Law, the pressure and volume of a gas are inversely proportional, meaning that as one increases, the other decreases, as long as the temperature and amount of gas remain constant. Therefore, if the pressure of a gas decreases, its volume should increase, and vice versa. It is represented as:

P₁V₁ =P₂V₂

where P₁ and V₁ are the initial pressure and volume, and P₂ and V₂ are the final pressure and volume, respectively.

According to given data

P₁= 0.73 atm

P₂= 0.1 atm

V₁= 5.64 L

Using Boyle's Law, we can calculate the new volume of the gas when its pressure drops to 0.1 atm:

P₁V₁ =P₂V₂

(0.73 atm)(5.64 L) = (0.1 atm)(V₂)

V₂ = (0.73 atm)(5.64 L) / (0.1 atm)

V₂= 41.41 L

Therefore, the new volume of the gas should be 41.41 L when its pressure drops to 0.1 atm

To know more about Boyle's law here

https://brainly.com/question/31524242

#SPJ1


Related Questions

A clear, pure liquid sample is brought into the lab and exposed to an electrical current. Different gases are produced on each of the electrodes. The sample is -
(4 points)
a. a polymer
B. an element
c. a compound
D. an alloy

Answers

It would be a compound.

Which of the following conditions on Mars would be the first to kill a human who is unprotected and unassisted by life support?
A
Colder than Antarctic temperatures.
B
Low air pressure.
C
High CO2 atmosphere.
D
Excess solar radiation due to a missing magnetic field.

Answers

Answer:

D

Excess solar radiation due to a missing magnetic field.

Explanation: Solar proton events (SPEs) are bursts of energetic protons accelerated by the Sun. They occur relatively rarely and can produce extremely high radiation levels. Without thick shielding, SPEs are sufficiently strong to cause acute radiation poisoning and death.

Hope this hels

plz mark brainliest

The average atomic mass of potassium is 39.098 amu. This element has 3 naturally occurring isotopes K-39, K-40, and K-41. Which is likely to be most abundant?

Answers

Answer:

k-39

Explanation:

also pls mark brainliest <3 :)))

Answer- k-39

Explanation:

it is the closest to the actual amu

PLS HELP!!!!

The potential energy of the reactants is about
100 kJ
40 kJ
20 kJ
60 kJ

PLS HELP!!!!The potential energy of the reactants is about100 kJ40 kJ20 kJ60 kJ

Answers

A and B are the reactants and the potiential energy is 40kj

just read from the graph

fill in the blank. "Hydration is a specific example of the phenomenon known generally as __________.
a. solvation
b. disordering
c. dilution
d. salutation
e. condensation"
a. solvation

Answers

Hydration is a specific example of the phenomenon known generally as a. solvation

The act of hydrating involves combining or dissolving an object in water. It is a particular instance of the more general phenomena known as solvation, which is the process by which solvent molecules surround and scatter a solute to create a homogeneous solution. However, hydration explicitly refers to solvation with water as the solvent.

Solvation may also happen with solvents other than water. Solvation is the process through which a solute and solvent interact to stabilise a solute species. Due to its impact on the solubility, reactivity, and behaviour of compounds in solution, solvation is a crucial mechanism in many chemical and biological processes.

Read more about solvation on:

https://brainly.com/question/530845

#SPJ4

A wave has a frequency of 35 Hz and a wavelength of 15 meters, what is the speed of the wave?

Answers

Answer:

1174.392 mph

Explanation:

.....................

How much heat is absorbed by 150. 0 g of ice as it

melts at 0°C?

Answers

150.0 g of ice absorbs 49.97 kJ of heat as it melts at 0°C.

To calculate the amount of heat absorbed by 150.0 g of ice as it melts at 0°C, we need to use the heat of fusion of water, which is the amount of heat required to melt one mole of a substance at its melting point. For water, the heat of fusion is 6.01 kJ/mol.

The first step is to determine the number of moles of ice present in 150.0 g,

n = m/M

n = 150.0 g / 18.02 g/mol

n = 8.32 mol

Next, we can use the heat of fusion to calculate the amount of heat absorbed by the ice as it melts,

q = n x ΔHfus

q = 8.32 mol x 6.01 kJ/mol

q = 49.97 kJ

To know more about heat, here

brainly.com/question/13995216

#SPJ4

How much heat is required to raise the temperature of 8.0 g of water by 3.0 °C ?


How much heat is required to raise the temperature of 8.0 g of water by 3.0 C ?

Answers

Answer: i really dont know are there answer choices

Explanation:

Determine the percent yield forthe reaction between 82.4 g of Rband 11.6 g of O2 if 39.7 g of Rb2Ois produced

Answers

Step 1

The reaction is written and balanced:

4 Rb + O2 =>2 Rb2O

-----------

Step 2

Define % yield of product (Rb2O) = (Actual yield/Theoretical yield) x 100

The actual yield is provided by the exercise = 39.7 g

----------

Step 3

Determine the limiting reactant. The molar masses are needed to solve this:

For Rb) 85.4 g/mol

For O2) 32 g/mol

Procedure:

4 Rb + O2 =>2 Rb2O

4 x 85.4 g Rb ----- 32 g O2

82.4 g Rb ----- X = 7.72 g O2 are needed

For 82.4 g Rb, 7.72 g O2 is needed, but there is 11.6 g O2. Therefore, O2 is the excess agent. Rb is the limiting reactant.

--------

Step 4

Determine the theoretical yield from the limiting reactant:

The molar mass Rb2O) 187 g/mol

Procedure:

4 x 85.4 g Rb ------ 2 x 187 g Rb2O

82.4 g Rb ------ X = 90.2 g Rb2O = Theoretical yield

---------

Step 5

% yield = Actual y./Theoretical y. x 100 = (39.7 g/90.2 g) x 100 = 44 % approx.

Answer: % yield = 44 %

Calculate the molar mass of ammonium chloride

Answers

Answer:

53.491 g/mol

Explanation:

Create the chemical compound and find each individual element's molar mass. Lastly, add them up.

How is thermal energy distributed in most heating systems?

A.
convection

B.
conduction

C.
radiation

Answers

Answer:

By Convection

Explanation:

Which physical property is used to be Indentify the ability to dissolve

Answers

Answer:

solubility

Explanation:

solubility is a measure of how much a substance will dissolve in a solvent.

Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT
HELP ME PLEASEEEEE !!

Answers

Answer:

Explanation:

Every A will be paired with a T, and every C with a G and vice versa (T to A, and G to C)

So the first letters in the sequence are ATGGG. So the pair will be TACCC.

Draw the neutral organic product that results from the given reaction. Include all hydrogen atoms. CH_3CH_2CH_2OH(I) H_2SO_4 (conc) /200^∘C

Answers

The neutral organic product obtained from the reaction is propene (CH3CH=CH2)

What is the role of concentrated sulfuric acid in the dehydration of 1-propanol?

The given reaction involves the dehydration of 1-propanol (CH3CH2CH2OH) in the presence of concentrated sulfuric acid (H2SO4) at 200°C. Dehydration is the removal of a water molecule from the alcohol compound. In this case, 1-propanol loses a water molecule to form propene (CH3CH=CH2), which is an alkene.

The neutral organic product resulting from this reaction is propene (CH3CH=CH2). The reaction occurs as the hydroxyl group (-OH) of 1-propanol is protonated by the acidic H2SO4, leading to the loss of a water molecule. This creates a double bond (C=C) between the second and third carbon atoms, resulting in the formation of propene.

Thus, the neutral organic product obtained from the reaction is propene (CH3CH=CH2).

Learn more about neutral organic product brainly.com/question/17313223

#SPJ11

write all products and relevant tests and observations when KOH reacts with NH4NO3​

Answers

Answer:

get a bucket and a mop that's a wap that's wap I'm talking wobble wobble wobble that's a wap

A balloon that can hold 35 L of air is inflated with 2.5 moles of gas at a pressure of 2.5
atmosphere. What is the temperature in °C of the balloon?

Answers

Answer:

The temperature of the balloon is approximately 153.4°C.

Explanation:

To find the temperature in Celsius of the balloon, we can use the ideal gas law.

Ideal Gas Law

\(\boxed{\sf PV=nRT}\)

where:

P is the pressure measured in atmospheres (atm).V is the volume measured in liters (L).n is the number of moles.R is the ideal gas constant (0.08206 L atm mol⁻¹ K⁻¹).T is the temperature measured in kelvin (K).

Given values:

P = 2.5 atmV = 35 Ln = 2.5 molR = 0.08206 L atm mol⁻¹ K⁻¹

Substitute the values into the formula and solve for T:

\(\implies \sf 2.5 \cdot 35 = 2.5 \cdot 0.08206 \cdot T\)

\(\implies \sf T=\dfrac{2.5 \cdot 35}{2.5 \cdot 0.08206}\)

\(\implies \sf T=\dfrac{87.5}{0.20515}\)

\(\implies \sf T=426.5178...\;K\)

As the temperature should be in Celsius, we need to convert from kelvin to Celsius by subtracting 273.15:

\(\implies \sf T=426.5178...\;K-273.15=153.4^{\circ}C\)

Therefore, the temperature of the balloon is approximately 153.4°C.

1. Describe what happens to water particles as you increase/decrease the temperature/pressure? (hint: movement/speed, attraction, density, volume, state of matter)
2. Describe and explain what happens to balloons when they are heated/cooled
3. Describe what happens to a cold beverage container on a hot day?
4. Explain how a glass (mercury) thermometer works.

Answers

1) The speed of the particles would increase when heated

2) The balloon would expand when heated and contract when cooled.

3) On a hot day, the pressure of the gas in a beverage increases

4) The mercury thermometer works by expanding or contracting in response to temperature change.

What is effect of temperature?

We know that one of the effects of temperature is that it is able change the molecular motion of an object. Thus the molecules of an object are able to move faster when heat is applied and they are able to slow down when the heat is removed.

This is why a balloon would have a greater volume when the temperature is increased as the gas molecules spread out. The volume would reduce or decrease when the temperature is reduced.

Also, on a hot day, a beverage would tend to be more fuzzy as the pressure of the gas in the beverage would increase as the temperature is increased.

Lastly, when we use the mercury thermometer, the volume of the mercury would increase and this is the reason for the expansion of the mercury during temperature measurement.

Learn more about temperature:https://brainly.com/question/11464844

#SPJ1

A student adds a tablespoon of sugar to a glass containing tea and ice cubes. The mixture is then stirred until all the sugar dissolves.

Which observation is a clue that the student's final mixture is heterogeneous
A. Some ice cubes are floating in the tea
B. The sugar crystals are no longer visible in the tea
C. The mixture looks the same throughout
D. Some water droplets form on the outside of the glass
The subject is science

Answers

Answer:

The correct option is;

A. Some ice cubes are floating in the tea

Explanation:

A heterogenous mixture is one that is made up of more than one clearly identifiable phase of matter (such as solid and liquid, liquid and gas, gas and solid, or solid, liquid and gas combined) and therefore having non-uniform composition, which varies from one section to another within the mixture.

Ice cubes which are solids being observable on the surface of the mixture provides clue that the student has made an heterogenous mixture.

the stock buffer solution contains 1.00 m na2co3 and 0.143 m nahco3. calculate the milliliters of stock buffer needed to prepare 500 ml of buffer containing 0.0125 m bicarbonate ion

Answers

Moles of bicarbonate ion in 500 mL of desired solution = (0.0125 mol/L) × (0.500 L) = 0.00625 mol

What is solution?

A solution is a means of solving a problem or addressing an issue. It can range from a simple, practical solution to a complex scientific or technological solution. Solutions are often creative, and the best solutions often involve collaboration and the sharing of ideas and resources.

Moles of bicarbonate ion in 1 L of stock buffer solution = (1.00 mol/L Na2CO3) × (2 mol HCO3-/1 mol Na2CO3) + (0.143 mol/L NaHCO3) × (1 mol HCO3-/1 mol NaHCO3) = 2.286 mol/L
Moles of bicarbonate ion in 500 mL of stock buffer solution = (2.286 mol/L) × (0.500 L) = 1.143 mol
Moles of bicarbonate ion needed from stock buffer solution to make 500 mL of desired solution = 0.00625 mol
Milliliters of stock buffer solution needed = (0.00625 mol/1.143 mol) × (500 mL) = 54.2 mL

To learn more about solution
https://brainly.com/question/25326161
#SPJ4

A stock solution of magnesium chloride has a concentration of 120 mgml. how many milliliters of the stock solution are required to prepare 1.5 l of 25 mgml solution?

Answers

312.5 mL of magnesium chloride stock solution is needed to prepare 1.5 L of 25 mg/mL solution.

This type of chemical process is called dilution. It is the addition of water into a small amount of a concentrated solution or a stock solution to make it less concentrated. In this problem, the equation below is used.

(Concentration of stock solution)(Volume of stock solution needed)=(Resulting concentration of solution)(Resulting volume of solution)

For easier writing of the equation, subscript 1 can be assigned to the concentrated solution and subscript 2 for the diluted solution.

C1*V1=C2*V2

Substituting the given to the formula:

(120 mg/ml)*(V1)=(25 mg/ml)*(1.5 L)

V1= 0.3125 L

V1= 312.5 ml

For more information regarding the dilution process, please refer to the link https://brainly.com/question/6692004.

#SPJ4

Can anything change solutions? Be
specific!

Answers

what kind of solutions?
what solutions are u referring to

Under what conditions which make it possible for water to exist in all 3 states on earth?

Answers

Water can exist in all three states—solid, liquid, and gas—under specific temperature and pressure conditions on Earth. These conditions are commonly found at the Earth's surface.

At temperatures below 0°C (32°F) and normal atmospheric pressure, water freezes and forms solid ice. In this state, water molecules are tightly packed in a crystalline structure.

At temperatures between 0°C and 100°C (32°F to 212°F) and normal atmospheric pressure, water exists as a liquid. In this state, water molecules have enough energy to move and flow freely.

At temperatures above 100°C (212°F) and normal atmospheric pressure, water vaporizes and becomes a gas. This process is known as boiling. In the gaseous state, water molecules have high energy and are widely dispersed.

These temperature and pressure conditions allow for the presence of liquid water in oceans, rivers, and lakes, solid water in the form of ice caps and glaciers, and gaseous water in the atmosphere as water vapor.

To know more about atmospheric pressure, refer here:

https://brainly.com/question/28310375#

#SPJ11

How many minutes are In 3,417 seconds?

Answers

Answer:

57 minutes and 35 seconds, or 56.95

Explanation:

Answer:

56.95 minutes

Explanation:

hope it helps

A gas with a volume of 5m3 is compressed from a pressure of 300kpa to a pressure of 700kpa. if the temperature remains unchanged,what is the resulting volume​

Answers

The resulting volume of the gas is approximately 2.14 m^3.

According to Boyle's Law, when the temperature of a gas remains constant, the product of its pressure and volume is constant. Mathematically, P1 * V1 = P2 * V2, where P1 and V1 are the initial pressure and volume, and P2 and V2 are the final pressure and volume, respectively.

Given:

Initial volume (V1) = 5 m^3

Initial pressure (P1) = 300 kPa

Final pressure (P2) = 700 kPa

Rearranging the Boyle's Law equation to solve for the final volume (V2), we get:

V2 = (P1 * V1) / P2

Substituting the given values into the equation, we find:

V2 = (300 kPa * 5 \(m^3\)) / 700 kPa

Evaluating the expression, the resulting volume of the gas is approximately 2.14 \(m^3\).

Therefore, when the temperature remains unchanged, the resulting volume of the gas is approximately 2.14\(m^3\).

Learn more about  Boyle's Law here:

https://brainly.com/question/21184611

#SPJ11

Absorption of ultraviolet light by organic molecules always results in what process?A.Bond breakingB.Excitation of bound electronsC.Vibration of atoms in polar bondsD.Ejection of bound electrons

Answers

B) Absorption of ultraviolet light by organic molecules always results is Excitation of bound electrons.

B is the response to this query. Electronic excitation always happens when organic compounds absorb ultraviolet light. Bond breaking, ionization, or bond vibration may then follow, but none of these outcomes is assured by the absorption of UV light.

Due to the ultraviolet light's high frequency, which causes the electrons in an atom's outer shell to leap out of their ground state when excited, organic molecules that absorb ultraviolet light cause the bound electron to be excited. The energy that is transferred from the light to the atoms is what is causing this excitation.

To know more about ultraviolet:

https://brainly.com/question/3091095

#SPJ4


What would the corresponding
concentration values of H₂O be
for pH values: 1, 3, 5, 7, 9, 11?

Answers

Answer:

7,9,11

Explanation:

this is because water includes 0H, which would mean that it is more than 6

If the mass is 3.8g and the volume is 3 ml/cm. What is the DENSITY?

Answers

Answer:

1.26666.....

Explanation:

Density is = to mass/volume

Answer: 19/15 in decimal form 1.267

Explanation:

when solving for density you divide mass by volume, when solving vor volume divide density and mass, finding mass multiply density and volume

in what way are the transition metals different than the alkali metals and alkaline earth metals?

Answers

Transition metals are much stronger and denser than alkali metals and alkaline earth metals and it is located between group 2 and group 3 of the periodic table.

Alkali metals and alkaline earth metals form ions with a +1 charge while the transition metals can form ions with variable charges. The transition metals are much harder, stronger and denser. They have much higher melting points . The transition metals are much less reactive. The alkali metals react with water, oxygen and halogens while the transition metals either react very slowly or do not react at all. A group 1 of the periodic table that is alkali metal will tarnish in the presence of oxygen as a metal oxide is formed. When cut with a knife the shiny appearance of the metal disappears in seconds as it is covered by the dull metal oxide.

To learn more about Transition Metals please visit:

https://brainly.com/question/12843347

#SPJ4


A scients produces zinc iodide (Zn).
This is the method used
1. Viegh 0.500g of iodine
2 Dissolve the iodine in ethanol
3. Add an excess of zinc
4 Sir the mature until there is no further change
5. Fiter of the excess zinc
5. Evaporate of the ethanol
a Calculate the minimum mass of zinc that needs to be added to 0.500 g of iodine so
that the iodine fully reacts
The equation for the reaction is
Zn + Zniz
Relative atomic masses (Me): Zn = 65
1 = 127

Answers

Answer im a little confused what exactly you need answered. please clarify

Explanation:

Answer:

Environment is the nature and surroundings in which all plants, animals, humans and other living beings live and operate. ... It includes sunlight, atmosphere, land, water, plants, animals, sea life, minerals, different species and everything that occurs naturally on earth.

Explanation:

\( \: \: \: \)

A box has dimensions of 2.0 cm time 4.0 cm times 8.0 cm, what is the volume of the box in milliliters?

Answers

Answer:

64 mL.

Explanation:

From the question given above, the dimension of box is:

Dimension = 2 cm × 4 cm × 8 cm

Thus, the volume of the box is:

Volume = 2 cm × 4 cm × 8 cm

Volume = 64 cm³

Finally, we shall convert 64 cm³ to mL. This can be obtained as follow:

Recall:

1 cm³ = 1 mL

Therefore,

64 cm³ = 64 cm³ × 1 mL / 1 cm³

64 cm³ = 64 mL

Therefore, the volume of the box in millilitres (mL) is 64 mL.

Other Questions
If a customer decides to forgo the cash discount, then he should make his payment on the day after its expiration if he wants to minimize the cost of his trade credit. This statement is: O True O False which of the following exemplifies a political/legal trend in the general organizational environments? question 8 options: scarcity of medical equipment suppliers recruitment of highly skilled nurses regulations concerning the disposal of biological wastes high attrition rate of medical staff A middle school teacher estimates that 170 parents will attend the back to school informational meeting. A total of 147 parents actually attended the meeting. What is the percent error of the teacher's estimate rounded to the nearest tenth of a percent What are the three documents that are considered the legal blueprint of a condominium? The license nurse is caring for a client with an order for resoiratory isolation aftee obtaining the clients vital signs how shoukd the nurse remove the personal protective equipment sequence the events A client is in balanced suspension traction to maintain alignment of a fractured tibia. Which activities are safe for the client The statement of financial position for Farley Corporation at the end of the current year indicates the following:Bonds payable, 7%........................................ ........................................ $4,000,0006% Share capital preference, $100 par........................................ ........................ 1,000,000Share capital ordinary, $10 par........................................ ........................ 2,000,000Income before income taxes was $1,120,000 and income taxes expense for the current year amounted to $336,000. Cash dividends paid on ordinary shares were $300,000, and the ordinary shares were selling for $45 per share at the end of the year. There were no ownership changes during the year.InstructionsDetermine each of the following:(a) times interest earned.(b) earnings per share.(c) price-earnings ratio. three mortar mixes were prepared with water to cement ratios of 0.50, 0.55, and 0.60. three 2-in. mortar cubes were prepared for each mix. the cubes were cured for 7 days and then tested for compressive strength. the test results were as shown in the table below. compute the following: a. the compressive strength of each cube. b. the average compressive strength for each mix. Analyzing the Importance of the PharaohsWhat was the purpose of a pharaoh's marriage? Choose three correct answers.to unite peopleto find true loveto please the godsto form alliancesto expand territory receives information from the visual and auditory senses.TheA forebrainB. midbrainC. hindbrainD. brainstemPlease select the best answer from the choices providedD What happened after the creation of a new technology in 2004? nec 430.6(a)(1) requires that the motor full-load amperes listed in tables 430.247 through 430.250 be used to size all of the following, except for_______ . Use the following data:Obs x y z w1 10 100 10.0000 0.100002 20 220 11.0000 0.050003 30 350 11.6667 0.033334 5 40 8.0000 0.200005 5 30 6.0000 0.200006 30 400 13.3333 0.03333=== ==== ======= =======100 1140 60.0000 0.61667a) Estimate the function: Y = 1 + 2X + ub) Make a graphical representation of the estimated disturbance terms.c) Assuming that the standard deviation of the disturbance term is proportional toX, re-estimate the model.d) Comment on the differences between the estimated parameters.e) Calculate a 95% confidence interval for the parameter 2.Please use SAS or any statistical software to calculate the question The differential equation which has y^3 = Cx^4 3 as its general solution is: (a) y = (4y^3 +3) / (3xy^2)(b) y = (y^3 + 12) / (3xy^2) (c) y = (4y^3 12) / 3xy^2 (d) y = (4y^3 + 12) / 3xy^2 (e) None of the above. According to your textbook, when you are in a formal speaking situation the most effective way of gaining the initial attention of your audience after you walk to the front of the room is Group of answer choices An effective way to eliminate the dangers of social traps is to pass legislation that makes the selfish advantage of social traps less desirable. please select the best answer from the choices provided t f Drag the tiles to the correct boxes to complete the pairs.Match each irrational number with the number line on which it is represented. Yasuaki mows lawns for $6.75 an hour. If he spends 7 hoursmowing lawns during 1 weekend, how much money will he earn?A$40.50C $47.25B$46.95Dnone of these which of the following conditions were of key importance to the development of the professions?-the growth of industry-advances in technology-the growth of cities What is the implicit meaning of this passage? nick bumped into arif at the grocery store. "hi, arif," said nick. "ali and i are going out of town this weekend. could you please feed our dogs while we're away?" "of course,' said arif. "what time should i stop by your house?"