1. Given the double-stranded stretch of DNA below, determine the base sequence of
messenger RNA strand produced using this gene as the template. *Hint: Only one of the
two strands is used as the template.
5'ATGCCATTGCTTAAGCGGGCATTATATCCAAGA 3'

3' TACGGTAACG AATTCGCCCGTAAT ATĄGGTACT 5


AUGCCAUUGCUU AAG-CGG-GCAULAUAU CCA UGA

How many amino acids will this protein contain?

Answers

Answer 1

Answer:

AUG-CCA-UUG-CUU-AAG-CGG-GCA-ULA-UAU-CCA-UGA

so 11

Explanation:

because every 3 bases code for 1 amino acid and to make it easier to count split into 3 so u can count easily.

hope this helps :)


Related Questions

Which of the following helps female gametes mature?
a
hormone

b
progesterone

c
testosterone

d
estrogen

Answers

The answer is D, estrogen

Answer:

d estrogen

Explanation:

Ovaries make eggs and hormones like estrogen and progesterone. These hormones help girls develop, and make it possible for a woman to have a baby. The ovaries release an egg as part of a woman's cycle.

what is the most common pathogenic microorganism you recorded in data table 1? what is a type of treatment for this pathogen?

Answers

The most common pathogenic microorganism that can be recorded in Data Table 1 is Escherichia coli. A type of treatment for this pathogen includes administering antibiotics, especially the fluoroquinolone and cephalosporin antibiotics, along with plenty of fluid intake.

A pathogen is a microorganism that causes disease in an organism. Pathogens can be bacteria, viruses, fungi, or other microorganisms. They are often harmful and can cause infections and diseases.What is Escherichia coli?Escherichia coli is a common bacterium that is found in the gut of humans and other animals.

It is a gram-negative, rod-shaped bacterium that is responsible for many cases of foodborne illnesses and urinary tract infections (UTIs).The type of treatment for Escherichia coli infection is through the administration of antibiotics. Fluoroquinolone and cephalosporin antibiotics are often used to treat E. coli infections. Additionally, fluid intake is encouraged to prevent dehydration that can occur due to diarrhea and vomiting caused by the infection.

To know more about antibiotics visit:

https://brainly.com/question/10868637

#SPJ11

In the early days of life on Earth, plants were exposed to extremely high doses of ultraviolet radiation, Constant UV exposure
resulted in some land plants developing narrow leaves with thick, waxy cuticles. Over many, many generations, these narrow
leaves evolved into needles.
Relate the development of plant needles to the occurrence of mutations,
A)
Plant needles adaptations for survival that some plants developed due to
high temperatures on Earth
B)
Plant needles are the result of leaf cell mutations that made some leaves
thick and waxy, while other leaves did not change,
Plant needles are the result of neutral mutations to leaf tissue that would
neither help nor harm the plants living in such a harsh environment.
D)
Plant needles were a beneficial mutation that increased survival of certain
plants that reproduced and passed the mutated gene to offspring,

Answers

Answer:

B I think.

Explanation:

According to the PHET gene expression simulation linked out in the PCA, what two proteins are needed to produce an mRNA for Gene 1? mRNA destroyer Positive transcription factor Ribosome RNA polymerase

Answers

According to the PHET gene expression simulation linked in PCA, the two proteins needed to generate mRNA for Gen 1 are transcription positive and RNA polymerase.

In genetics, transcription factors are a group of proteins in the cell nucleus that participate in the transcription of the genetic code into mRNA. Transcription factors are the final link in signal transduction pathways that convert extracellular signals into modulations of genetic expression.

The transcription component consists of DNA and RNA polymerase enzymes. The DNA strand is used as a template to form mRNA. Meanwhile, the RNA polymerase enzyme plays a role in the formation and elongation of the mRNA (mRNA) chain.

So positive transcription factors and RNA polymerase are the proteins needed to produce mRNA for Gen 1. mRNA is produced from DNA molecules through the process of transcription.

Learn more about transcription factors at https://brainly.com/question/29056552

#SPJ4

Do pcr primers have to anneal to ends of dna templates or can they anneal to middle regions of template dna?.

Answers

PCR primers are used to amplify specific regions of DNA. Primers bind to the template DNA and serve as the starting point for the synthesis of new DNA strands by DNA polymerase. PCR primers can anneal to both ends of DNA templates and to the middle regions of template DNA.

PCR primers are short, synthetic oligonucleotides that are designed to anneal to specific regions of the template DNA. During PCR, the temperature of the reaction mixture is cycled between different temperatures, including a step at which the temperature is lowered to allow primers to anneal to the template DNA. The specificity of the PCR reaction is determined by the specificity of the primers, which are designed to bind only to the target region of the DNA template.

Therefore, PCR primers can anneal to both ends of DNA templates and to the middle regions of template DNA.PCR is a powerful tool for amplifying specific regions of DNA, and the ability to design primers that can anneal to different regions of the DNA template allows for greater flexibility in experimental design.

To know more about DNA visit:

https://brainly.com/question/32162247

#SPJ11

how could a laboratory researcher determine if there are differences among the brine shrimp

Answers

A laboratory researcher could determine if there are differences among the brine shrimp by conducting a statistical analysis of their characteristics, such as their size or survival rate under specific conditions.

The researcher could start by randomly selecting a sample of brine shrimp and measuring their characteristics. For example, they could measure the length of each shrimp and record the data. The researcher could then use a statistical test, such as a t-test or ANOVA, to compare the mean lengths of the different samples of brine shrimp. If the test reveals a significant difference in the mean lengths of the shrimp, it suggests that there are differences among them.

Another approach could be to expose different groups of brine shrimp to different conditions, such as varying levels of salinity or temperature, and monitor their survival rates. The researcher could then use a statistical test to compare the survival rates of the different groups and determine if there are significant differences among them.

In conclusion, a laboratory researcher could determine if there are differences among the brine shrimp by measuring their characteristics and conducting a statistical analysis. This analysis can help identify differences in size or survival rates under specific conditions and provide valuable insights into the behavior and adaptation of these tiny aquatic creatures.

To know more about brine shrimp ,visit:

https://brainly.com/question/31083231

#SPJ11

PLZ HELP ME 20 POINTS AND BRAINESIT
What is the world's largest source of surface water?
The Atlantic ice cap
The Antarctic ice cap
he Greenland ice cap
None of the above

Answers

Answer:
The Antarctic Ice Cap

Consider the following statement.
(A) The wings of birds and insects are homologous structures
(B) The wings of insects and bats are analogous structures
(C) The wings of bats and birds are homologous structures
(D) The wings of birds and insects are analogous structures
Choose the option which includes only the correct statements.
A. A and C
B. B and D
C. A, B, and D
D..A, C, and D

Answers

The wings of birds, bats, and bugs are analogous structures; they serve a similar capability of flight however their construction and beginning are unique in relation to one another. The correct answer is (B and D).

The wings of a bird and of a bug are practically equivalent to organs. Both of these species have wings that they use for flight but their wings came from different genealogical starting points.

Strangely, however bird and bat wings are practically equivalent to wings, as forelimbs they are homologous. Birds and bats didn't acquire wings from a typical predecessor with wings, however, they acquired forelimbs from a typical progenitor with forelimbs.

They are organs that have different life structures but carry out comparative roles and have various starting points. they are created because of the transformation to a comparative climate. Bug and bird wings carry out a comparative role in flying however have various designs. Along these lines, they are known as practically equivalent to organs.

To learn more about analogous structures here

https://brainly.com/question/16701939

#SPJ4

How can you justify that Golgi exhibits the phenomenon of membrane flow?

Answers

The phenomenon of membrane flow is a good thing to do with the lake and the house is a bit too high to see

What elements are necessary to support a wide variety of life for a given region?

Answers

The most crucial substances are carbon, hydrogen, oxygen, and nitrogen. Life requires trace amounts of other elements. In living things, carbon predominates over all other elements.

Water and sunlight are the most vital ingredients or elements required to sustain a wide variety of life in a certain area. Soil is another essential component since it aids in the growth of plants and crops. There is also a need for air that is sufficiently oxygenated. Given that savanna/woodland habitats have the highest concentrations of people, they are the vegetation types where human activity and living things is most likely to have a detrimental impact on species diversity.

Tp know more about oxygen, click here:

https://brainly.com/question/13370320

#SPJ4

The most crucial substances are carbon, hydrogen, oxygen, and nitrogen. Life requires trace amounts of other elements. In living things, carbon predominates over all other elements.

Water and sunlight are the most vital ingredients or elements required to sustain a wide variety of life in a certain area. Soil is another essential component since it aids in the growth of plants and crops. There is also a need for air that is sufficiently oxygenated. Given that savanna/woodland habitats have the highest concentrations of people, they are the vegetation types where human activity and living things is most likely to have a detrimental impact on species diversity.

Tp know more about oxygen click here:

brainly.com/question/13370320

#SPJ4

Determine the statement that accurately describes what creates Earth seasons.

A. Earth's seasons occur as a 23.5° orbit occurs during a 365 day revolution around the Sun.
B. Earth's seasons occur due to a 23.5° axial tilt toward or away from the Sun during a 365 day revolution around the Sun.
C. Earth's seasons occur as a 23.5° orbit occurs during a 365 day rotation around the Sun.
D. Earth's seasons occur due to a 23.5° axial tilt toward or away from the Sun during a 365 day rotation around the Sun.

Answers

Seasons are caused by the fact that the Earth is tilted on its axis by 23.5°. The tilt's orientation with respect to space does not change during the year.

Answer:

The statement that accurately describes what creates Earth's seasons is: B. Earth's seasons occur due to a 23.5° axial tilt toward or away from the Sun during a 365 day revolution around the Sun.

Explanation:

Earth's axis is tilted at an angle of approximately 23.5° relative to its orbit around the Sun. As Earth orbits the Sun, the tilt of the axis causes different parts of the Earth to receive different amounts of solar energy. This results in the seasonal variations in temperature and daylight that we experience on Earth.

During the summer months, the North Pole is tilted toward the Sun, causing the Northern Hemisphere to receive more direct sunlight and experience longer days and warmer temperatures. During the winter months, the North Pole is tilted away from the Sun, resulting in shorter days and cooler temperatures in the Northern Hemisphere. The opposite is true for the Southern Hemisphere, where the seasons are reversed.

I hope this helps!

Which statement about Earth's rotation and its revolution is correct?

It takes Earth longer to rotate on its axis than to revolve around the Sun.


It takes Earth longer to rotate around the Sun than to revolve on its axis.


It takes Earth longer to revolve around the Sun than to revolve on its axis.


It takes Earth longer to revolve around the Sun than to rotate on its axis.

Answers

Answer:

It takes Earth longer to revolve around the sun than to rotate on its axis.

It takes the sun 365 days to revolve around the sun and 24 hours to rotate on its axis.

Let me know if this helps!

While traveling in Italy, Layla and her friends stop into a quaint restaurant. The menu looks so intriguing that Layla asks the server what they would suggest they get. The server says that it is traditional to order several large dishes and then share them among the table. Which type of dining is this called?

Answers

Answer:

"Family Dining"

(Also can you add all the answer options? So I can give you a better answer?)

Explanation:

what is a difference between prokaryotic and eukaryotic cells that we can exploit when using antibiotics?

Answers

The key difference between prokaryotic and eukaryotic cells that can be exploited when using antibiotics is the structure and composition of their cellular components. Prokaryotic cells, such as bacteria, have simpler structures, lacking membrane-bound organelles like nuclei, mitochondria, and endoplasmic reticula.

Eukaryotic cells, found in animals, plants, and fungi, have more complex structures and contain these membrane-bound organelles.

Antibiotics target specific components of prokaryotic cells that are not present or significantly different in eukaryotic cells. For example, antibiotics can target the bacterial cell wall, which is made up of peptidoglycan.

Eukaryotic cells do not have a cell wall made of peptidoglycan, so these antibiotics specifically affect prokaryotic cells without harming eukaryotic cells.

Another difference that can be exploited is the ribosomes, which are responsible for protein synthesis. Prokaryotic ribosomes are smaller (70S) compared to eukaryotic ribosomes (80S). Some antibiotics, like tetracyclines and macrolides, selectively target the bacterial 70S ribosome, preventing protein synthesis and eventually killing the bacterial cell without affecting the eukaryotic cells.

In summary, the structural differences between prokaryotic and eukaryotic cells, such as cell wall composition and ribosome size, can be exploited when using antibiotics to selectively target and eliminate prokaryotic cells without causing harm to eukaryotic cells.

To know more about prokaryotic refer here

https://brainly.com/question/15329345#

#SPJ11

most blood from the brain flows down the internal jugular veins and then into

Answers

Most blood from the brain flows down the internal jugular veins and then into the heart.

This process is essential for the proper functioning of the body. What is the Internal Jugular Vein? The internal jugular vein is a vein in the neck that drains blood from the brain and face. It is one of the primary veins that connect the brain to the rest of the body. When blood is no longer required in the brain, it flows down the internal jugular vein into the heart. Blood flows in veins because of the pressure gradient between different parts of the body. Blood in the veins is under low pressure, so it relies on a system of one-way valves and muscle contractions to move it towards the heart. When the muscle contracts, it pushes blood towards the heart, while the valve prevents blood from flowing backward and keeps it moving forward. This ensures that the blood reaches the heart to be recirculated to the rest of the body. Importance of Blood Flow from Brain to Heart: The process of blood flow from the brain to the heart is crucial for the proper functioning of the body. Blood carries oxygen and nutrients to the brain cells and removes waste products from them. This process ensures that the brain receives an adequate supply of oxygen and nutrients, which is essential for its proper functioning. It also helps in maintaining the blood pressure in the brain, preventing the brain cells from getting damaged.

To know more about , muscle visit

https://brainly.com/question/13920046

#SPJ11

Why do secondary sexual characters(jikffbihpz) grow during adolesecnece?

Answers

Answer:

typically develop during adolescence as a result of hormonal changes in the body.

Explanation:

I am not sure what you mean by "jikffbihpz." Could you please provide more context or clarify your question?

Also the term "secondary sexual characters" typically refers to physical characteristics that distinguish males from females in sexually reproducing species, such as antlers on male deer or breasts on human females. These characteristics are not related to the reproductive organs themselves (the primary sexual characteristics) and typically develop during adolescence as a result of hormonal changes in the body.

If a sperm cell of an organism contains 14 chromosomes how many chromosomes are in a autosomal cell of this organism

Answers

Answer: 28

Explanation:

n=14

2n=28

If a sperm cell of an organism contains 14 chromosomes, the number of chromosomes in an autosomal cell of this organism is 28.

What do you mean by Chromosomes?

Chromosomes may be defined as the small bodies in the nucleus of a cell that carry the chemical instructions for the reproduction of the cell.

Sperm cells have 14 chromosomes, which is determined as n, while the number of chromosomes in an autosomal cell is 2n, which is equal to 2 ×14 = 28.

Therefore, if a sperm cell of an organism contains 14 chromosomes, the number of chromosomes in an autosomal cell of this organism is 28.

To learn more about Sperm cells and autosomal cells, refer to the link:

https://brainly.com/question/15475960

What bonds with 2 hydrogens to form water?

Answers

Answer:

Oxygen

Explanation

yes

Answer:

oxygen

Explanation:

A water molecule consist of two hydrogen atoms bounded to an oxygen atom and it's overall structure are bent

Can anyone help me identify this crystal? Plz help. It’s dark green and has like a small line of brown and it has a little bit of sparkle in it

Can anyone help me identify this crystal? Plz help. Its dark green and has like a small line of brown

Answers

honestly it looks like a polished apache tear, which is just a stone.

Cancer is the uninhibited growth of cells. Which of the following would be most likely to
cancer?

Answers

Carcinomas that begin in different epithelial cell types have specific names: Adenocarcinoma is a cancer that forms in epithelial cells that produce fluids or mucus. Tissues with this type of epithelial cell are sometimes called glandular tissues. Most cancers of the breast, colon, and prostate are adenocarcinomas.

What variations can individuals exhibit?​

Answers

Explanation:

Organisms (within populations) exhibit individual variation in appearance and behavior. These variations may involve body size, hair color, facial markings, voice properties, or number of offspring.

can the need to protect the elephants environment be balanced with the need to protect the elephant

Answers

Answer:

there are times when your need to save elephant they balance life also so yes save elephants

Explanation:

which could be its function???

which could be its function???

Answers

Answer:

A

Explanation:

It seems to be a picture of the backbone of a vertebrate, i.e; human.

This is a fibrous protein so the answer is A.

what is the name of reproduction part in femal​

Answers

Uhhh it’s called a vulva I know this because I’m smart

The decision to use autoclave leaching may be to achieve high temperature leaching condition without loss of reagent, because higher pressures allow water to remain liquid at temperatures well above 100°C. In other instances, the reaction itself can occur well at ambient temperature, but high oxygen partial pressure is needed to increase availability of oxygen in solution, when oxygen concentration is the critical rate driving parameter. These operations employ different scientific and engineering knowledge. With this background, write a termpaper on, "Manufacture of titania pigment from ilmenite versus separation of tellurium from selenium in copper anodic slimes". In the term paper, address or present: 1. Differences between engineering and scientific knowledge, 2. Thermodynamics of leaching of ilmenite in hydrochloric acid for titania pigment production, 3. Thermodynamics of selective leaching of tellurium from anodic slime, 4. Ilmenite leaching operation for titania pigment production, 5. Tellurium leaching operation from anodic slime, 6. Table of examples of plants carrying out these operations with their operating parameters and production data, 7. Similar scientific and engineering knowledge applied in these operations (in a list), 8. Different scientific and engineering knowledge applied in these operations (in a list), 9. Probable areas of innovation going forward in the science and/or engineering of autoclave leaching. 10.Current titania pigment and tellurium market and t∣ drivers.

Answers

The term paper explores the differences between engineering and scientific knowledge, thermodynamics of leaching ilmenite for titania pigment production, selective leaching of tellurium from anodic slime, operational processes, examples of plants, and potential areas of innovation and current market drivers.

Title: Manufacture of Titania Pigment from Ilmenite and Separation of Tellurium from Selenium in Copper Anodic Slimes

Abstract: This term paper discusses the processes involved in the manufacture of titania pigment from ilmenite and the separation of tellurium from selenium in copper anodic slimes. It addresses the differences between engineering and scientific knowledge, thermodynamics of leaching ilmenite for titania pigment production, thermodynamics of selective leaching of tellurium, leaching operations for both processes, examples of plants conducting these operations, the scientific and engineering knowledge applied in these operations, areas of innovation in autoclave leaching, and the current market and drivers for titania pigment and tellurium.

1. Differences between engineering and scientific knowledge:

- Engineering knowledge focuses on the practical application of scientific principles to solve real-world problems, while scientific knowledge is concerned with understanding natural phenomena through observation, experimentation, and analysis.

2. Thermodynamics of leaching ilmenite in hydrochloric acid for titania pigment production:

- The thermodynamics of leaching ilmenite involve the study of energy transfer and chemical reactions during the process, considering factors such as temperature, pressure, concentration, and equilibrium.

3. Thermodynamics of selective leaching of tellurium from anodic slime:

- The selective leaching of tellurium from anodic slime requires an understanding of the thermodynamic principles governing the dissolution of tellurium and the selective inhibition of selenium.

4. Ilmenite leaching operation for titania pigment production:

- The ilmenite leaching operation involves treating ilmenite with hydrochloric acid to dissolve the titanium dioxide (TiO2) present and separate it from other impurities.

5. Tellurium leaching operation from anodic slime:

- The tellurium leaching operation aims to selectively dissolve tellurium while minimizing the dissolution of selenium from copper anodic slimes.

6. Table of examples of plants carrying out these operations with their operating parameters and production data:

- This table provides a comparative overview of different plants engaged in the manufacture of titania pigment from ilmenite and the separation of tellurium from selenium, including their operating parameters and production data.

7. Similar scientific and engineering knowledge applied in these operations (in a list):

- High-temperature chemistry

- Thermodynamics of chemical reactions

- Materials science and engineering

- Process optimization and control

- Environmental considerations

- Safety protocols

8. Different scientific and engineering knowledge applied in these operations (in a list):

- Titania pigment production: Mineral processing, mineralogy, separation techniques

- Tellurium separation: Electrochemistry, hydrometallurgy, selective leaching methods

9. Probable areas of innovation going forward in the science and/or engineering of autoclave leaching:

- Development of more efficient and selective leaching agents

- Novel reactor designs for improved mass and heat transfer

- Integration of renewable energy sources for sustainable operation

- Advancements in catalysts and adsorbents for enhanced process efficiency

10. Current titania pigment and tellurium market and drivers:

- The current market for titania pigment is driven by the growing demand for paints, coatings, and plastics in various industries such as automotive, construction, and consumer goods.

- The tellurium market is influenced by factors such as the increasing use of tellurium in solar panels, electronics, and thermoelectric devices, as well as advancements in renewable energy technologies.

In conclusion, the manufacture of titania pigment from ilmenite and the separation of tellurium from selenium in copper anodic slimes involve complex scientific and engineering processes. Understanding the thermodynamics, operational parameters, and market drivers is crucial for further advancements and innovation in autoclave leaching techniques.

For more such questions on thermodynamics, click on:

https://brainly.com/question/8062908

#SPJ8

Osteclats have more ... than other body cells because it does more breaking down/recycling than other tissues

Answers

Answer:

Resorbing action or breaking or proteolytic

Can someone please help me?​

Can someone please help me?

Answers

Answer:

Nucleic Acids, Carbohydrates, and Protein

Explanation:

Which strand of mRNA be made during transcriptions using the dna strand AGC GCT

Answers

mRNA is produced in the nucleus during transcription. This process involves the DNA template strand which is used to grow mRNA by complementing its bases. The resulting mRNA strand is UCG CGA.

What is transcription?

The first step before protein arrangement is to synthesize messenger RNA, mRNA.

Transcription is the synthesis of the messenger RNA, mRNA. This event occurs in the nucleus and uses fragments of DNA molecules to do it.

When the DNA molecule separates into two strands to form the transcription bubble, we can identify two separate segments: the coding strand and the template strand.

• The coding strand goes in direction 5' to 3',

• The complementary strand -template strand- grows in direction 3' to 5'.

The template strand is the one that is going to be complemented by the mRNA. RNA polymerase is in charge of reading the original DNA strand for mRNA synthesis.

mRNA molecule grows complementing DNA base sequences. This is,

 DNA           mRNA  

adenine  ⇔   uracil

guanine  ⇔   cytosine

thymine  ⇔   adenine

cytosine  ⇔   guanine  

Once mRNA synthesis is over, the molecule leaves the nucleus to start the translation process in the cytoplasm.

In the exposed example,

DNA template strand   ⇒ AGC GCTcomplementary mRNA ⇒ UCG CGA

Remember that RNA replaces Thymine by Uracyl.

The mRNA strand is then UCG CGA.

You can learn more about transcription at

https://brainly.com/question/8626164

https://brainly.com/question/9791055

#SPJ1

How does the ozone layer affect life on Earth? (Site 1)


Answers

by its refraction

Explanation:

ozone layer affect life on earth by its upcoming refraction to the living life of earth

Answer:

ozone layer affect life on earth by its upcoming refraction to the living life of earth

Explanation:

Edge

Which phenotype had the most reproductive success? Why?

Answers

Answer:

Explanation:Reproductive fitness reflects the ability of individuals to pass on their genes to subsequent generations. Fitness traits, also referred to as life-history traits, include measures of fertility and mortality and are complex phenotypes that are direct targets of Darwinian selection

Other Questions
Complete the table is it 99 and 68??? what did the constitution replace as our governing document in the united states? Zhang is 24 years old. He is in tech and wants toretire early. He makes $100,000 a year and has a lotof extra income every month. Should he be aconservative, moderate, or aggressive investor? 2.- Seat has a debtequity ratio of 1Its WACC is 10 percent, and its cost of debt is 5 percent.The corporate tax rate is 25 percent.Find cost of equity capitalWhat is the unlevered cost of equity capital?What would the cost of equity be if the debtequity ratio was 2? help = brainlist pls hshsvsjsn svshsismsnsbs In 275 words, describe the d-day invasion. what was france like before d-day? what operation occurred during this time? feel free to discuss any and all aspects of the event, as all pieces are relevant to a thorough understanding of d-day. for decades, social psychologists have endorsed gordon allports ideas about the conditions necessary for intergroup contact to reduce prejudice and discrimination. what is the goal of these "ideal" contact situations? It was Sarah's job to fill her neighbor's bird feeders with sunflower seeds while they were on vacation.She was given 12 cups of seeds to fill the 3 bird feeders. She filled the bird feeders for a whole week.How many cups of seeds did Sarah put in each bird feeder each day?Answer with a explanation A rectangular board is 1100 millimeters long and 800 millimeters wide. What is the area of the board in square meters? Do not round You have 20 quarters. You find 40% more in your room. Then you go to the store and spend 50% of them. How much money do you have left? please answer the question without a link May I please get help with this. I have tried multiple times but still could not get the correct answer or at least answer to them Kirk is ordering matching T-shirts for his basketball team, the Mighty Falcons. Each shirt costs $5.79. What is the total cost if Kirk buys 15 shirts? What are two examples of transitive property? put these locations in the order that an erythrocyte that is just leaving the right ventricle of a mammal would encounter.\ in a small town, there are two providers of broadband internet access: a cable company and the phone company. the internet access offered by both providers is of the same speed. competitive? Look at the image, read, and choose the correct sentence that goes with the image.Woman on bed in a hotel Hay un hotel grande entre Susana y su mochila. Hay una mochila roja sobre la cama del hotel. Susana est dentro del hotel sobre la cama. Susana habla conmigo debajo del hotel, sobre su pas, Costa Rica. Among fatal plane crashes that occurred during the past years, were due to pilot error, were due to other human error, were due to weather, were due to mechanical problems, and were due to sabotage. Construct the relative frequency distribution. What is the most serious threat to aviation safety, and can anything be done about it?. assume that you contribute $300 per month to a retirement plan for 25 years. then you are able to increase the contribution to $500 per month for 20 years. given a 9 percent interest rate, what is the value of your retirement plan after 45 years? multiple choice $2,189,194.36 $1,743,956.03 $2,355,040.91 $1,989,703.51 (4) Practice: Using Visual Cues